Table 1

MO sequences

GeneTargetMO sequence
npm1aATG/5′UTRTAATGTTATCCTCCATTTTTGCGCG
npm1aATG/5′UTR 5-bp mismatchTAATcTTATCgTCgATTTTaGCcCG
npm1aExon2-intron2 splice donor (2)*AAGAAACATCACATACCATTCTAAC
npm1aExon3-intron3 splice donorTTATGACCAAGTCTACTTACACTTG
npm1bATG/5′ UTRGACCCATCTGTTCGAGATCCATGTC
npm1bATG/5′UTR 5-bp mismatchGAgCCATgTGTTCGAcATCgATcTC
npm1bExon2-intron2 splice donorTCAAATATTCATCTTCCTCACCGAC
p53ATG/5′UTRGCGCCATTGCTTTGCAAGAATTG
Std contHuman β-globin intron mutationCCTCTTACCTCAGTTACAATTTATA
  • Bold letters indicate the ATG codon; lowercase letters, mismatched residues; and Std cont, standard control.

  • * (2) is the 1 working morpholino of 2 tested (supplemental Figure 1F, available on the Blood Web site; see the Supplemental Materials link at the top of the online article).