Table 1.

Primer sequences used for real-time PCR analysis of iron transporter transcripts

Forward primer (5′ to 3′)Reverse primer (5′ to 3′)
HPRT TTGTAGCCCTCTGTGTGCTCAAG GCCTGACCAAGGAAAGCAAAGTC
DMT1
(non-IRE) GGACCTAGGGCATGTGGCAT ACACAAGTGAGTCAGCGTGG
DMT1
(+ IRE) AGTGGTTTATGTCCGGGACC TTTAACGTAGCCACGGGTGG
IREG1 CGTCATTGCTGCTAGAATCG AGACTGAAATCAATACGAGC