Advertisement

Article Figures & Data

Figures

  • Fig. 1.

    Identification and mapping of MMSETgene on 4p16.3. (A) The diagram, drawn to scale, represents the distal 200 kb of the 2-Mb cosmid contig spanning the Huntington’s disease region, with the telomeric side of the contig, containing theFGFR3 gene, to the left. Vertical lines represent the exons distribution of the MMSET gene within about 120 kb of the cosmid contig. The MMSET gene includes at least 24 exons that are transcribed from the telomeric to the centromeric end. The solid arrowhead indicates the 3′ end of an EST that is localized 530 bp centromeric to the end of the last MMSET exon, but is transcribed in the opposite orientation. The solid arrows indicate the position of the previously cloned translocation breakpoints for KMS11, UTMC2, H929, JIM3, OPM2 MM cell lines, and for the tumor sample PCL1; The LP-1 breakpoint has been mapped by sequence analysis of a hybrid transcript splicing to exon 4, and MM5.1 between exons 2b and 3. The KMS11 t(4;14) translocation breakpoint is localized at the 5′ end of MMSET exon 1a, about 15 kb from exon 1; the UTMC2 breakpoint is localized between exon 1a and 1, about 2.5 kb from exon 1; the PCL1 breakpoint is in the intron between exons 1 and 2a; the LP-1, H929, and the JIM3 breakpoints are between exons 3 and 4; and the OPM2 breakpoint between exons 4 and 5. (B) The MMSET transcription units. MMSET is expressed as transcripts that polyadenylate either in exon 11 (type I), or exon 24 (type II) as a result of alternative splicing occurring from exon 10 to 11 (top), or exon 10 to 12 (bottom). The position of the polyadenylation signals (PA) is indicated by black circles. Because of the heterogeneity of the 5′ untranslated region (5′UT), we chose to start the numbering of MMSET from the first nucleotide in exon 3. The type I transcript contains an ORF of 1911 bp, encoding a 647-aa protein with the first methionine at nt 30, in exon 3, and the stop codon at nt 1971 after the first 20 aa of exon 11. The type II transcript contains a longer ORF of 4094 bp, encoding a 1365-aa protein, that is identical to the shorter protein up to the splicing site in exon 10, as indicated by the light gray shading. The two proteins differ after exon 10, with the unique portion of the short protein shaded in black, and the portion unique to the long protein shaded in dark gray. In the middle panel are shown characteristic domains of MMSET. A putative nuclear localization signal (NLS, indicated by a thick vertical line) is common to the two proteins, as well as the HMG domain (dark gray rectangle), and the hathdomain (white rectangle). The long protein is characterized by four PHD fingers (black rectangles), a SET domain (light gray rectangle), an additional hath domain, and another putative NLS. The thick horizontal lines represent the PCR amplified probes used in the Northern blot assay, with the primers number indicated. Numbers within boxes indicate two of the bacteriophage clones isolated from a testis cDNA library. To obtain a complete sequence of the ORFs of MMSET, cDNA fragments have been amplified by PCR as indicated by the dashed horizontal lines. 1112 (gray rectangle) is a clone obtained by 3′ RACE and sequenced with SP6 and T7 primers. (C) Amino acid sequence of MMSET long and short proteins. The numbers above the aa indicate the first residue of the corresponding exon. The first methionine in exons 3, 4, and 6 are in bold. In a white box are shown the two hathdomains; two putative nuclear localization signals (NLS) are underlined; in a dark grey box is indicated the HMG domain; the four black boxes show the PHD fingers, with the consensus histidine residues in bold; in a dark grey box is shown the SET domain.

  • Fig. 2.

    Expression of MMSET mRNA in myeloma cell lines and normal tissues. (A) A Northern blot containing 2 μg of poly(A)+ RNA from each of several normal tissues was assessed for MMSET expression hybridizing with an exon 3 probe. The two major bands of 7.7 and 5.2 kb reflect the two polyadenylation signals in exon 24; the lower bands (4.0, 3.1, and 2.8 kb) correspond to the alternative spliced form of MMSET type I containing exon 11, with polyadenylation at different sites. (B) Northern blot analysis of 15 μg of total RNA from 14 myeloma cell lines hybridized with a 3′ exon 24 MMSET probe. The arrow shows the 7.7-kb band, corresponding to the type II MMSET mRNA, that is polyadenylated at nt 7395 of exon 24. The position of 5.0- and 2.0-kb ribosomal RNAs is indicated. The lower panel shows the ethidium bromide staining of the blotted RNAs. (C) A Northern blot containing 2 μg of oligo-dT selected total RNA from MM cell lines with (JIM3 and UTMC2) and without (KMM1) a t(4;14) translocation was repeatedly hybridized with MMSET probes covering different exons. The size of the bands referred in the text is indicated. All three MMSET probes detected the 7.7-kb band (MMSET type II) that, in UTMC2 but not KMM1, cohybridize to the Iμ probe, consistent with the presence of a t(4;14) translocation. Exon 6-10 and exon 19-23, but not 3′ exon 24 probes, also hybridize to the 5.2-kb type II transcript. In addition, exon 6-10 probes detected an 8.8-kb and lower 4.0- and 3.1-kb bands, corresponding to MMSET type I transcript. In JIM3, the size of the bands detected by the exon 6-10 probes is about 600 bp smaller than in the other lines, because the translocation breakpoint is between exon 3 and 4. To obtain comparable signals, the KMM1 blot has been exposed approximately three times longer.

  • Fig. 3.

    The t(4;14) translocation results in IgH-MMSET hybrid transcripts. (A) The top diagram shows the genomic organization of the IgH locus on 14q32 in an IgG isotype switched plasma cell. The structural elements include the recombined VDJ exons, 5′ and 3′ enhancers (Eμ and 3′E), the noncoding Ιμ (gray rectangle) and coding Cγ (white rectangle) exons, and the switch regions (circles). The transcription may initiate either from promoters (black arrowhead) upstream of JH or Iμ, in both cases with splicing to the Cγ exon. The second diagram shows the 4p16 locus, with FGFR3 on the telomeric side, and MMSET on the centromeric side. The MMSET exons are depicted as black rectangles. The main promoter upstream of exon 1 and a cryptic promoter upstream of exon 4 are depicted. The alternative splicing occurring between exon 10-11 or exon 10-12 is shown. The lower two diagrams represent the der(4) and der(14) as result of the t(4;14) translocation in JIM3 MM cell line. On der(4), the transcription may initiate at a lower level either from (VD)J or Iμ, and in both cases it splices to exon 4 of MMSET, proceeds up to exon 10 and then it splices to exon 12, but not exon 11. However, the transcription preferentially initiates from the upregulated MMSET promoter upstream of exon 4 and generates both types of alternatively spliced forms of MMSET. On the der(14), the reciprocal hybrid transcript is formed when the transcription starts from the MMSET promoter upstream of exon 1, and it splices to the Cγ exon. (B) An RT-PCR assay detects hybrid transcripts Iμ-MMSET (top panel) and JH-MMSET (middle panel) on der(4), and MMSET-Cγ (bottom panel) on der(14) in myeloma cell lines and primary tumor samples with t(4;14) translocation. The IgH exons are shaded in gray, and the MMSET exons are depicted as white rectangles. The exon structure of each hybrid transcripts is depicted and has been obtained by sequencing of the PCR product (Iμ-MMSET and MMSET-Cγ), or deduced by the size of the PCR products, consistent with the breakpoint position (JH-MMSET).

Tables

  • Table 1.

    PCR and RACE Primers

    Exon Sense Antisense Sequence
    1a o134CTTGCCTGGCTATCACCAG
    1 o99CCGAGGATGCGACGCACCGCAG
    3 5541CTGACTGAGACACATCAGCAGCAC
    3 5760GGGGACTCTGCTTGATGCTAA
    3 5540CATCTGGGCTGGATGGAATTTAG
    4 5761CTCTTCCAGTGTTTGGACAAG
    6 o58AAGCCAAGTTCACCTTTCTCTATGTG
    6 o48CCTCAATTTCCCTGAAATTGGTT
    7 o103AAGAGCTGCTCAGGTCACAGTGG
    10 o143CTCCTTCTGCATCCTTAACTG
    11 o93CCTTACCATGCAAAAATGCGGAC
    19 o76GTGCAACTGCAAGCCCACAGATG
    24 o77GCCACACACGTCACAATGATGCC
    24 o80ATATCTAGAGTGGCGGTAACGCTGAGGAGTGA
    24 o83TCCTTGGCATCCGAAACCAG
    24 o82CCGTGGGACACAGGCATTTTAC
    5518CAGATCTGAAAGTGCTCTACTG
    o52AGGATCCGGCAGCAGAAGCCACGCATCCCAGCTCTG
    5536AGCCCTTGTTAATGGACTTGGAGG
    JH1 5590CCCTGGTCACCGTCTCCTCA
    JH3 5592CAATGGTCACCGTCTCTTCA
    o64TGTCCTTGGGTTTTGGGGGGAA
    o65TCTCTCAGGCCGGTCAGTGTGC
    o132GAAGACGCTCACTTTGGGAGG
    RACE 5051TAGGAATTCGATCTCGAGGCTTTTTTTTTTTTTTTTT(ACG)
    RACE 5052TAGGAATTCGATCTCGAGGC
    • The sequence of the primers used in a PCR assay to amplify probes for the Northern blot analysis and to screen the cDNA library, in RACE experiments, for sequencing analysis, and for amplification of hybrid transcripts are listed below in a 5′-3′ orientation.

  • Table 2.

    MMSET Exon Structure

    Exon Size bp First nt First Codon4p16 Cosmid First nt Last nt
    1a218 75b9b 8204 7986
    1 244gap a-b −3008 −2743
    2a 100184d6 14925 14803
    2b 139184d6 14339 14200
    2c 200184d6 13376 13199
    2d 174184d6 7888 7714
    2e 41?184d6 7536 7496?
    3 626 1 1184d6 6483 5858
    4 163 627 200 184d62893 2731
    5 167 790 254 190b4 1988519719
    6 483 957 310 190b4 18615 18133
    7 145 1440 471 190b4 6129 5985
    8119 1585 519 190b4 1610 1492
    9 821704 559 19h1 38351 38270
    10 125 1786586 19h1 37148 37024
    11 6454 1911 62819h1 34463 27985
    12 132 1911 628 19h125731 25601
    13 124 2043 672 19h1 2471924596
    14 201 2167 713 19h1 23503 23303
    15 180 2368 780 19h1 21666 21487
    16157 2548 840 19h1 21134 20978
    17 2062705 893 19h1 20844 20639
    18 104 2911961 19h1 18894 18791
    19 270 3015 99619h1 17356 17087
    20 118 3285 1086 19h115792 15676
    21 142 3402 1125 19h1 19561815
    22 107 3544 1172 19h1 1525 1419
    23 205 3651 1208 19h1 344 140
    243563 3856 1276 96a2 33362 29800
    • In the first column are listed the MMSET exons; a double line separates exon 11 and 12, indicating that they are contained in two alternative MMSET transcripts (type I and II, respectively). In the second column is reported the size of each exon. In the third column is indicated the first nucleotide of the exon, numbered starting from exon 3. The fourth column shows the first codon of the exon; the first Methionine in exon 3 corresponds to nucleotide 30. The fifth column lists in which 4p16 cosmid the exon is contained, with the first and last nucleotide indicated in columns six and seven. The position of exon 1 is arbitrarily given as distance in nt from the firstSst I site (at position 2501) of 75b9b.