Advertisement

Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Screening of 29 Translocations and Chromosomal Aberrations in Acute Leukemia

Niels Pallisgaard, Peter Hokland, Dorthe C. Riishøj, Bent Pedersen and Poul Jørgensen

Article Figures & Data

Figures

  • Fig. 1.

    Multiplex RT-PCR and split-out analysis. (A) The two cell lines MV-4-11 and Mono-Mac-6 and patient no. 243 were positive for a translocation in multiplex reaction R5 (see Table 3). (B) To determine the translocation, a split-out PCR analysis was performed using the individual primer sets R5A, R5B, R5C, and R5D. M, DNA molecular weight marker VI (Boehringer).

  • Fig. 2.

    Examples on chromosomal aberrations found by the multiplex RT-PCR. The loading order and DNA molecular weight marker are as in Fig 1. The band specific for the translocation is indicated by an arrowhead beside the band. The dots indicate activation of HOX11 (lane 4) or EVI1 (lane 7). Because HOX11 and EVI1 represent activation of native gene products and not of chimerical products, these are not further discussed in this presentation. *Patient no. 335 was a chronic myeloid leukemia case not included in this study.

Tables

  • Table 1.

    Chromosomal Alteration Included in the Multiplex RT-PCR Analysis

    Chromosomal Alteration Genes Involved Fusion Gene*PCR Mix No.Size of PCR FragmentPositive Cell Line Presence Reference
    t(X;11)(q13q23) MLL (11q23) MLLex6/AFX R1C 488T
    AFX (Xq13) MLLex7/AFX R1C235 (480) T
    MLLex8/AFX R1C449 (694) Karpas-45§ ALL 7
    MLLex9/AFX R1C 596 (841) T
    TAL1D SIL (1p34) SIL/TAL1 R3D 183RPMI8402 T-ALL 32, 37
    TAL1 (1p34)
    t(1;11)(q21;q23) MLL (11q23) MLLex6/AF1qR5E 300 AMMOL 13
    AF1q (1q21) MLLex7/AF1q R5E 187 T
    MLLex8/AF1q R5E 301 (546) T
    MLLex9/AF1q R5E 448 (693) T
    t(1;11)(p32;q23) MLL (11q23) MLLex6/AF-qpR2A 300 ALL 10
    AF1p (1p32) MLLex7/AF-1p R2A 187 (432) T
    MLLex8/AF-1p R2A 301 (546)T
    MLLex9/AF-1p R2A448 (693) T
    t(1;19)(q23;p13) E2A(19p13) E2A/PBX1 (1) R3A 376 697 ALL 28, 38, 39
    PBX1 (1q23) E2A/PBX1 (1a)R3A 403 ALL 39
    t(2;5)(p23;q35) NPM(5q35) NPM/ALK R8D 302 Karpas-299 ALCL, T-/B-cell lymphomas 40, 41
    ALK (2p23)
    t(3;5)(q25.1;q34) NPM (5q35) NPM/MLF1 R8F 289 MDS, AML 42
    MLF1 (3q25.1)
    t(3;21)(q26;q22) AML1 (21q22) AML1ex5/MDS1/(EVI1) R4B 446 SKH1§ CML-BC, AML, MDS 43-45
    MDS1 (3q26)
    (EVI1) (3q26) AML1ex6/MDS1/(EVI1)R4B 638 CML-BC, AML, MDS 44, 45
    t(4;11)(q21;q23) MLL (11q23) MLLex6/AF4 (a:1414) R5A 317 ALL 14, 16, 46
    AF4(4q21) MLLex7/AF4 (a:1414) R5A204 (449) RS4; 11 ALL 14, 16, 46
    MLLex8/AF4 (a:1414) R5A318 (563) ALL 16, 17, 46
    MLLex8/AF4 (a:1414) R5A465 (710) T
    MLLex6/AF4(b:1459) R5A 272 MV-4-11 ALL 17, 46
    MLLex7/AF4 (b:1459) R5A159 (404) ALL 14, 17, 46
    MLLex8/AF4 (b:1459) R5A273 (518) ALL 14, 17
    MLLex9/AF4 (b:1459) R5A420 (665) T
    MLLex6/AF4(c:1546) R5A 185 T
    MLLex7/AF4 (c:1546) R5A72 (317) ALL 17
    MLLex8/AF4 (c:1546) R5A186 (431) ALL 14, 17, 46
    MLLex9/AF4 (c:1546) R5A333 (578) T
    t(5;12)(q33;p13) TEL(12p13) TEL/PDGFR R6D 321 CMML, MDS 47
    PDGFR (5q33)
    t(5;17)(q35;q22) NPM(5q35) NPM(S)/RAR R8E 105 APL 48
    RAR (17q21) NPM(L)/RAR R8E 234 APL 48
    t(6;9)(p23;q34) DEK(6p23) DEK/CAN R7A 320 AML 49
    CAN (9q34)
    t(6;11)(q27;q23) MLL (11q23) MLLex6/AF6 R1D 308 ML-2 AML, ALL¶ 8, 20
    AF6 (6q27) MLLex7/AF6 R1D 195 (440) AML 20
    MLLex8/AF6 R1D 309 (594) T
    MLLex9/AF6 R1D 456 (741)T
    t(7;10)(q35;q24) Activation of HOX11 R4D 212 RPMI8402 T-ALL 50, 51
    t(8;21)(q22;q22) AML1 (21q22) AMLex5/ETO R4A 353 Kasumi-1§ AML 5, 45, 52
    ETO (8q22)
    ?t(9;9) SET(9q34) SET/CAN R7B 393 AUL 53
    CAN (9q34)
    t(9;11)(p22;q23) MLL (11q23) MLLex6/AF9 (A) R5C 321 AML 14
    AF9 (9p22) MLLex7/AF9 (A) R5C208 (453) Mono-Mac-6 AML 14
    MLLex8/AF9 (A) R5C322 (567) Mono-Mac-6 AML 14
    MLLex9/AF9 (A) R5C469 (714) T
    MLLex6/AF9(B) R5D 367 AML 19, 20
    MLLex7/AF9 (B) R5D254 (499) T
    MLLex8/AF9(B) R5D 368 (613) T
    MLLex9/AF9 (B) R5D515 (760) T
    t(9;12)(q34;p13) TEL(12p13) TEL/ABL R6C 366 ALL 54
    ABL (9q34)
    t(9;22)(q34;q11) BCR (22q11) BCR/ABL e1a2 R6A 320 ALL 23, 55
    ABL (9q34) BCR/ABL b2a2 R6B 472CML 23, 55
    BCR/ABL b3a2 R6B 397CML 23, 55
    t(10;11)(p12;q23) MLL (11q23) MLLex5/AF10 (A;2222) R2C 202 AML 56, 57
    AF10 (10p12) MLLex6/AF10(B:979) R2D 270 AML 56, 57
    MLLex7/AF10 (B:979) R2D157 (402) AML 57
    MLLex8/AF10 (B:979) R2D271 (516) T
    MLLex9/AF10(B:979) R2D 418 (663) T
    MLLex6/AF10 (C:2110) R2C 388AML 56, 57
    MLLex7/AF10 (C:2110)R2C 275 (520) T
    MLLex8/AF10 (C:2110) R2C389 (634) T
    MLLex9/AF10(C:2110) R2C 536 (781) T
    MLLex6/AF10 (D:883) R2D 366AML 57
    MLLex7/AF10 (D:883)R2D 253 (498) AML 57
    MLLex8/AF10 (D:883) R2D367 (612) T
    MLLex9/AF10(D:883) R2D 514 (759) T
    MLLex6/AF10 (E:589) R2E 267AML 57
    MLLex7/AF10 (E:589)R2E 154 (399) T
    MLLex8/AF10 (E:589) R2E268 (513) T
    MLLex9/AF10(E:589) R2E 415 (660) T
    MLLex5/AF10 (F:1931) R2C 493AML¶
    t(10;14)(q24;q11) HOX11 (10q24)Karpas-299 AML, ALL, CML¶
    dupMLL (11q23) MLL (11q23) MLLex5/MLLex2 R2F184 ALL¶
    MLL (11q23) MLLex6/MLLex2 R2F 258 AML, ALL 15, 20, 21
    MLLex7/MLLex2 R2F145 (390) AML 21
    MLLex8/MLLex2 R2F 259 (504)AML 21
    MLLex9/MLLex2 R2F406 (651) AML 21
    t(11;17)(q23;q21) PLZF (11q23) PLZF/RAR (A:1365) R8A 315APL 58, 59
    RARA (17q21) PLZF/RAR(B:1452) R8A 402 APL 59
    t(11;17)(q23;q21) MLL (11q23) MLLex5/AF17 R2B 281AML 11
    AF17 (17q21)
    t(11;19)(q23;p13.1) MLL (11q23) MLLex6/ELL R1E 330T
    ELL (19p13.1) MLLex7/ELL R1E 217 (462) AML 9, 60, 61
    MLLex8/ELL R1E 301 (576)T
    MLLex9/ELL R1E448 (723) T
    MLLex6/ELL-ins120 R1E 450 T
    MLLex7/ELL-ins120 R1E337 (582) AML 60
    MLLex8/ELL-ins120 R1E451 (696) AML 60
    MLLex9/ELL-ins120 R1E598 (845) T
    t(11;19)(q23;p13.3) MLL(11q23) MLLex6/ENL (A:177) R5B 186ALL 14, 17
    ENL (19p13.3) MLLex7/ENL (A:177) R5B 73 (318)KOCL-44§ ALL 14, 17
    MLLex8/ENL(A:177) R5B 187 (432) KOCL-44§ ALL 14, 17
    MLLex9/ENL (A:177) R5B334 (579) T
    t(12;21)(p13;q22) TEL(12p13) TEL/AML1 R3C 293 ALL 62
    AML1 (21q22) TEL/AML1 R3C 332ALL 62-64
    t(15;17)(q21;q22) PML (15q21) PMLex3/RARα ex2 R8C 393 NB4 APL 65-67
    RAR (17q21) S-form (=BCR3)
    PMLex3/RARα ex2 R8C 338 NB4APL 66
    S-form splice variant
    PMLex6/RARα ex2 R8B 427 NB4APL 66, 67
    L-form (=BCR1)
    PMLa ex3 Δex5 + 6/ R8C 464 NB4 APL 67
    RARα ex2,
    L-form splice variant
    PML ex6-(+/−)ins- R8B +/−427APL 66
    RAR ex2
    V-form (=BCR2)
    inv(16)(p13q22) CBF (16q22) CBF/MYH11 (A) R1A 270 ME-1§ AML 68
    MYH11 (16p13) CBF/MYH11 (B) R1B 483AML 68
    CBF/MYH11 (C) R1B 663AML 68
    CBF/MYH11 (D) R1A 337AML 68
    CBF/MYH11 (E) R1A 544AML 68
    CBF/MYH11 (F) R1B 174AML 68
    CBF/MYH11 (G) R1B 241AML 68
    CBF/MYH11 (H) R1B 348AML 68
    t(16;21)(p11;q22) TLS (16p11) TLS/ERG (a) R4C 318 UTP-L12§ AML 69
    ERG (21q22) TLS/ERG (b) R4C 274UTP-L12§ AML 69
    TLS/ERG (c) R4C239 UTP-L12§ AML, ALL 69
    TLS/ERG(d) R4C 344 ALL¶
    TLS/ERG (e)R4C 413 ALL¶
    t(17;19)(q22;p13) E2A(19p13) E2Aex13/HLFex4 (I) R3B 390HAL-01 ALL 70-72
    HLF (17q22) E2Aex13insHLFex4 (I) R3B 417 ALL 72
    E2Aex12/HLFex4 (II) R3B 207ALL 72
    • Abbreviations: No, number; t, translocation; inv, inversion; p, short chromosome arm; q, long chromosome arm; ex, exon; ins, insertion; T, theoretically possible translocation variant; AML, acute myelogenous leukemia; ALL, acute lymphoblastic leukemia; CML (-BC), chronic myeloid leukemia (in blast crisis); MDS, myelodysplastic syndrome; APL, acute promyelocytic leukemia; AUL, acute undifferentiated leukemia; CMML, chronic myelomonocytic leukemia; ALCL, anaplastic large cell lymphoma; AMMOL, acute myelomonocytic leukemia.

    • *Letters and numbers in parentheses after the fusion-gene indicates alternative breakpoints and/or splice variants.

    • †R1 through R8 indicate multiplex reaction number; suffixes A through F indicate split-out reaction.

    • §Cell line not available for testing described as positive: ME-1 in reference 73, Karpas-45 in reference 7, Kasumi-1 in reference 74, SKH1 in reference 43, UTP-L12 in reference 69, KOCL-44 in reference 14.

    • ‡Numbers in parentheses indicate the size of the co-amplified PCR fragment resulting from the MLL exon 5 primer.

    • ¶Novel variants detected in this study.

  • Table 2.

    Specific cDNA Primers

    Name*Sequence 5′ to 3′
    ABL:797L12 GCTGCCATTGAT
    AF10:1150L12 ACCTGAGCTGTG
    AF10:2392L12 CCACTGCCTCTC
    AF10:750L13 GTAGCCACAGTAT
    AF17:1965L11 GACACCGGAAG
    AF1P:445L12 ATGGGAGCTCAG
    AF1Q:804L12 AGGGCTTTTGAG
    AF4:1664L12 TTCCTTGCTGAG
    AF6:355L12 CCGATCATCTTT
    AF9:1536L12 CTGCCATCACTT
    AF9:1910L12 GCATCCAGTTGT
    AFX1:70L12 AAGTGCCAACAG
    ALL1:417L13 TTTGGTCTCTGAT
    AML1A:1921L12 CGGTAGCATTTC
    AML1MDSEVI:2459L12CCCATCCATAAC
    AML1MDSEVI:4905L12 TAAGGCTGCTCT
    CAN:2896L12 TTGGCTGGTACT
    E2A:1960L11 GCTTCGCTCAG
    ELL:456L12 CCAGCCTTGATG
    ENL:137L12 TCTCCACGAAGT
    ERG:1000L12 TGTAGGCGTAGC
    ETO:350L12 GTGCGAACTCTT
    HLF:1181L12 GGCCTCATACTT
    HOX11:897L11 TGCTGCCTCTC
    MLF1:320L12 TGGTCTGGAAAG
    MYH11:1552L12 CTGCTGGGTGAG
    MYH11:2271L12 AGCTGCTTGATG
    NPMALK:714L12CAGCGAACAATG
    PBX1:526L11 CCCTCCAGAAG
    PDGFR:2451L12CTGCAGGAAGGT
    RARA:700L12 CGGTCGTTTCTC
    TAL1:263L11CCGTGCCTCTA
    • *The primer-names contain the name of the gene (or fusion-gene) used to construct the primer, the 5′ nucleotide number where the primer starts, U or L denotes forward or backward, and the length of the primer. Underlining indicates the gene where the primer is located.

    • Primers used for detection of HOX11 and EVI1expression. The use of these primers is not discussed further in this presentation.

    • PBX = PML.

  • Table 3.

    Primers Used in the Multiplex PCR

    Multiplex No. Split-Out ReactionPrimers 1. PCR Primers 2. PCR
    Name Sequence 5′ to 3′ Name Sequence 5′ to 3′
    R1AB CBFB:267U22 TTTGAAGGCTCCCATGATTCTG CBFBMYH:344U21TGGGCTGTCTGGAGTTTGATG
    A MYH11:2198L22AGGTCCCCTTCCAGCTTCTTCT MYH11:2041L19 TGAGCGCCTGCATGTTGAC
    B MYH11:1438L24 GAGCTGGATGTTGAGAGTGGAGATMYH11:1387L20 TCCTCGTCCAGCTGGTCTTG
    CDE MLL:3730U20CCGCCTCAGCCACCTACTAC MLL:3751U20 GGACCGCCAAGAAAAGAAGT
    CDE MLL:3955U24 AGCACTCTCTCCAATGGCAATAGTMLL:3996U24 AGCAGATGGAGTCCACAGGATCAG
    C AFX1:29L20GGGTGACTGGCAGCACAGAT AFX1:5L24 GGTTTCTTCTTGGGGGCTTTAACT
    D AF6:279L21 CCGCTGACATGCACTTCATAG AF6:242L22GAGGACAGCATTCGCATATCAG
    E ELL:351L23ACACCGTGATCTTGTCCTGTATG ELL:306L22 TTCCCCATGACTGGAGACATAC
    ABCDE E2A:1075U21 TTCTCGTCCAGCCCTTCTACC E2A:1173U19CTACGACGGGGGTCTCCAC
    ABCDE E2A:1883L22TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19 AGGTTCCGCTCTCGCACTT
    R2 ABCDEF MLL:3730U20 CCGCCTCAGCCACCTACTACMLL:3751U20 GGACCGCCAAGAAAAGAAGT
    ABCDEF MLL:3955U24AGCACTCTCTCCAATGGCAATAGT MLL:3996U24AGCAGATGGAGTCCACAGGATCAG
    A AF1P:273L22GGATACCTTTGCCATCTGTGTC AF1P:255L22 TGTCGGCTAAATCCCAAATCT
    B AF17:1937L21 CCTCCAGGTCTGGCTCTGTGT AF17:1834L23GTAGAGCCAGCCAGAGAAAACAC
    C AF10:2363L23CTGTTCTATGCTGGCTGCTACTG AF10:2327L21 AACTGCTGTTGCCTGGTTGAT
    D AF10:1109L22 TTGCCCTCTGACCCTCTAGTCT AF10:1074L23TTCCACTAGAGGTGTGTGCAGAG
    E AF10:728L22TGGACATTATCGGCACCATTAC AF10:685L21 GGCAAACTGAGCGCATGTTAC
    F MLL:391L23 TTTAGAGGGGAAAACACAGATGG MLL:333L22TCTAGGTCTCCCACGAGGTTTT
    ABCDEF E2A:1075U21TTCTCGTCCAGCCCTTCTACC E2A:1173U19 CTACGACGGGGGTCTCCAC
    ABCDEF E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCAE2A:1884L19 AGGTTCCGCTCTCGCACTT
    R3 A PBX1:459L18* GCCACGCCTTCCGCTAAC PBX1:436L21 CATGTTGTCCAGCCGCATCAG
    D SIL:24U19 CGACCCCAACGTCCCAGAG SIL:83U20CCCGCTCCTACCCTGCAAAC
    D TAL1:203L21CGGTCATCCTGGGGCATATTT TAL1:179L20 AGACCGGCCCCTCTGAATAG
    B HLF:1140L20 GCCCAGCTCCTTCCTCAAGT HLF:998L20CGCCTTGCCCAGTACTTGTC
    C TEL:871U23CACTCCGTGGATTTCAAACAGTC TEL:944U23 CTCATCGGGAAGACCTGGCTTAC
    C AML1A:1891L23 AGCCGAGTAGTTTTCATCATTGCAML1A:1772L21 AGCACGGAGCAGAGGAAGTTG
    ABCDE2A:1075U21 TTCTCGTCCAGCCCTTCTACC E2A:1173U19CTACGACGGGGGTCTCCAC
    ABCD E2A:1883L22TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19 AGGTTCCGCTCTCGCACTT
    R4 AB AML1A:1863U21 GATGGCACTCTGGTCACTGTGAML1A:1885U20 TGGCTGGCAATGATGAAAAC
    BAMLMDSEVI:2375L24 CGATCTTCCTTTTGGTCCATATTCAMLMDSEVI:2345L21 CCCCAGGCATATTTGACTCTC
    D HOX11:590U20 GGGCGTCAACAACCTCACTG HOX11:617U22CTTCCCCTGGATGGAGAGTAAC
    D HOX11:857L21GTCTGCCGTCTCCACTTTGTC HOX11:810L19 GCGCATCGGTCATTTTGAG
    A ETO:327L23 TCTCCTATCTCGGGTGAAATGTC ETO:116L22CGTTGTCGGTGTAAATGAACTG
    C TLS:649U19GGTGGCGGTTATGGCAATC TLS:690U19 CAGCGGTGGCTATGGACAG
    C ERG:908L22 GTTCATGTTGGGTTTGCTCTTC ERG:833L19GGTGCCTTCCCAGGTGATG
    ABCD E2A:1075U21TTCTCGTCCAGCCCTTCTACC E2A:1173U19 CTACGACGGGGGTCTCCAC
    ABCD E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCAE2A:1844L19 AGGTTCCGCTCTCGCACTT
    R5 ABCDEMLL:3730U20 CCGCCTCAGCCACCTACTAC MLL:3751U20GGACCGCCAAGAAAAGAAGT
    ABCDE MLL:3955U24AGCACTCTCTCCAATGGCAATAGT MLL:3996U24AGCAGATGGAGTCCACAGGATCAG
    A AF4:1636L29GAATTTGAGTGAGTTTTTGAAGATGTATC AF4:1606L25GTTTTTGGTTTGGGTTACAGAACT
    D AF9:1869L24AF9:1818L24 GAGCAAAGATCAAAATCAAATGTT
    CAF9:1498L22 CCAGATGTTTCCAGGTAACTCTGT AF9:1466L26CTCCATTTCAGAGTCATTGTCGTTAT
    E AF1Q:660L22TTCGGCTGCCTCCTCTATTTAC AF1Q:580L20 TGCTGGCAATGGGAGCTCTC
    B ENL:81L22 GCTTGAGAGGGAAGACAATGAG ENL:30L19GCGATGCCCCAGCTCTAAC
    ABCDE E2A:1075U21CACCATCCAGTCGTGAGTGAAC E2A:1173U19 CTACGACGGGGGTCTCCAC
    ABCDE E2A:1883L22 TTCTCGTCCAGCCCTTCTACC E2A:1844L19AGGTTCCGCTCTCGCACTT
    TTTTCCTCTTCTCGCCGTTTCA
    R6 ABCR:1698U19 CGCTCTCCCTCGCAGAACT BCR:1777U19ACTGCCCGGTTGTCGTGTC
    B BCR:3060U23GAGTCACTGCTGCTGCTTATGTC BCR:3128U22 CACGTTCCTGATCTCCTCTGAC
    ABC ABL:661L20 TTTTGGTTTGGGCTTCACAC ABL:642L23ACACCATTCCCCATTGTGATTAT
    CD TEL:309U21GCTGCTGACCAAAGAGGACTT TEL:343U24 CCTCATTCAGGTGATGTGCTCTAT
    D PDGFR:2282L22 CATAAGGGCTTGCTTCTCACTGPDGFR:2090L22 CATGGGGTCCACGTAGATGTAC
    ABCDE2A:1075U21 TTCTCGTCCAGCCCTTCTACC E2A:1173U19CTACGACGGGGGTCTCCAC
    ABCD E2A:1883L22TTTTCCTCTTCTCGCCGTTTCA E2A:1844L19 AGGTTCCGCTCTCGCACTT
    R7 A DEK:870U24 TGCCAATGTTAAGAAAGCAGATAG DEK:892U21AGCAGCACCACCAAGAAGAAT
    AB CAN:2872L21GGCAAGGATTTGGTGTGAGAT CAN:2642L20 GTCTCTCGCTCTGGCACAAG
    B SET:468U23 CACCCGAAATCAAATGGAAATCTG SET:552U24TGAGGAACCAGAGAGCTTCTTTAC
    C AMLMDSEVI:4331U23CCACTAAGCGAAAGGATGAGAAG AMLMDSEVI:4509U21CGTCGAATCAAGACCTGCTTC
    C AMLMDSEVI:4866L21TGCCGTGTTAGGTTTGCAGAC AMLMDSEVI:4746L25GAACATAGAGGGCACTGACTGTAAG
    ABC E2A:1075U21TTCTCGTCCAGCCCTTCTACC E2A:1173U19 CTACGACGGGGGTCTCCAC
    ABC E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCA E2A:1884L19AGGTTCCGCTCTCGCACTT
    R8 A PLZF:1092U21CCACAAGGCTGACGCTGTATT PLZF:1252U21 GTGGGCATGAAGTCAGAGAGC
    B PML3:1211U19 CAAGAAAGCCAGCCCAGAG PML3:1370U21GCCAGTGTACGCCTTCTCCAT
    C PML3:861U19GTGCGCCAGGTGGTAGCTC PML3:930U20 CAGCGCGACTACGAGGAGAT
    ABCE RARA:540L19 AAGCCCTTGCAGCCCTCAC RARA:508L22CCCATAGTGGTAGCCTGAGGAC
    DEF NPM:290U25ACGAAGGCAGTCCAATTAAAGTAAC NPM:403U21 GGTTCAGGGCCAGTGCATATT
    D NPMALK:627L21 CACACTTCAGGCAGCGTCTTCNPMALK:590L19 CTTGGGTCGTTGGGCATTC
    FMLF1:235L27 AGCTCTCCCTCTACCATCAGAGATACT MLF1:192L28AAAGGGTTCAGAAAAACTTCTTATCATC
    ABCDEF E2A:1075U21TTCTCGTCCAGCCCTTCTACC E2A:1173U19 CTACGACGGGGGTCTCCAC
    ABCDEF E2A:1883L22 TTTTCCTCTTCTCGCCGTTTCAE2A:1844L19 AGGTTCCGCTCTCGCACTT
    • The nomenclature of the primers is as in Table 2.

    • * PBX = PML.

    • Primers used for detection of HOX11 and EVI1expression. The use of these primers is not discussed further in this presentation.

  • Table 4.

    Multiplex RT-PCR and Cytogenetic Data on 102 AML Patients

    UPN3-150Status Sex Age (yr) SampleMultiplex RT-PCR Karyotype
    A
       15 Presen. F30 PB t(8;21)(q22;q22) 46,XX,t(8;21)(q22;q22)[5]
       16 Presen. F 18 PB t(8;21)(q22;q22)46,XX[1]/47,XX,ins(1)(q11;?),+mar[5]
       19 Presen.F 2.5 BM t(6;11)(q27;q23) 46,XX[10]
       20Presen. M 68 PB inv(16)(p13;q22)46,XY[2]/46,XY,inv(16)(p13q22)[8]
       22 Presen.M 9 PB t(10;11)(p12;q23)46,XY,t(10;11)(q23;q25)[3]/47,XY,ibid,der(19)t(1;19)(q21;p13 or q13)[9]
       23 Relapse F 38 PBt(6;9)(p23;q34) 46,XX,t(6;9)(p23;q34)[10]
       25Relapse M 43 PB inv(16)(p13;q22)46,XY[4]/46,XY,inv(16)(p13q22)[6]
       29 RelapseM 73 PB t(8;21)(q22;q22)46,XY,t(8;21)(q22;q22)[6]
       31 Presen. M 64PB dupMLL(11q23) Failed
       43 RelapseM 72 PB dupMLL(11q23) Failed
       44Presen. M 84 PB dupMLL(11q23)47,XY,+8[3]/48,XY,+8,+18[7]
       48 Presen. F34 BM t(9;11)(q22;q23) 46,XX[4]
       62Presen. F 24 BM dupMLL(11q23)46,XX[2]
       67 Remis. M 52 PBdupMLL(11q23) 46,XY[1]/46,XY,del(9)(q?31)[4]
       70 Remis. M 60 PB dupMLL(11q23)46,XY[10]
       73 Presen. F 1.0 PBt(10;11)(p12;q23)46,X,der(X)t(X;1)(q13;q12),10,der(11)t(10;11)(q22;q23),+mar[11]
       75 Presen. F 38 BM t(11;19)(q23;p13.1)46,XX,[8]/47,XX,+8[2]
       84 Presen. M 57PB t(15;17)(q21;q22)46,XY[1]/47,XY,+Y[6]/48,XY,+Y,+?21[2]
      137 Presen.M 60 BM dupMLL(11q23) Failed
      181Presen. F 40 PB t(8;21)(q22;q22)46,XX,dup(1)(q21qter),add(14q)[10]
      186 Presen. M41 PB t(8;21)(q22;q22)46,XY,t(3;3)(q26,q29)[8]/47,XY,idem,+21[2]
      192Presen. M 76 PB dupMLL(11q23)46,XY[1]
      208 Presen. F 66 PBt(6;9)(p23;q34) 46,XX[2]
      212 Relapse F 55PB dupMLL(11q23) 47,XX,+83-150[1]
      221Presen. F 44 PB inv(16)(p13;q22) 46,XX[10]
      223 Presen. F 63 PB inv(16)(p13;q22)46,XX[1]
      267 Presen. M 70 PBt(15;17)(q21;q22) 46,XY,t(15;17)(q?22;q11.2)[8]
      342Presen. F 23 PB t(15;17)(q21;q22) 46,XX[10]
     10023-151 Presen. M 69 PB t(15;17)(q21;q22)47,XY,+8[4]/47,XY,+8,del(17)(q?24)[10]
     10043-151 Presen.M 65 PB t(15;17)(q21;q22) 46,XY[5]
    B
      18 Presen. M 2.0 PB inv(16)(p13;q22) ND
     118 Presen. M 57 PB inv(16)(p13;q22) ND
     119 Presen. M 77 PB t(15;17)(q21;q22) ND
     122 Presen. F 41 PB t(9;22)(q34;q11) ND
     125 Presen. M 21 PB dupMLL(11q23)ND
     128 Presen. F 55 PB t(8;21)(q22;q22)ND
     129 Presen. M 21 BMdupMLL(11q23) ND
     132 Presen. M 43BM t(8;21)(q22;q22) ND
     145 Presen. F 82PB t(9;22)(q34;q11) ND
     148 Presen. F 59PB t(9;22)(q34;q11) ND
     161 Presen. M 79PB t(15;17)(q21;q22) ND
     172 Presen. F 71PB dupMLL(11q23) ND
     193 Presen. F55 PB t(8;21)(q22;q22) ND
     200 Presen. M33 PB t(6;11)(q27;q23) ND
     240 Remis. M1.0 PB t(2;5)(p23;q35) ND
    C
      28Presen. F 38 PB NAD 46,XX[6]
      34Presen. M 75 PB NAD Failed
      36Presen. F 53 PB NAD 46,XX[10]
      39Presen. M 23 PB Ins. N/Q cells46,XY,t(15;17)(q22;q21)[10]
      45 Presen. F 62BM Ins. N/Q cells 46,XX[4]/47-48,X,idic(X),+8[cp.6]
      46 Presen. F 49 PB NAD 46,XX[10]
      47 Presen. M 65 PB NAD 47,XY,+8[10]
      51 Presen. F 83 PB NAD46,XX[7]/48-49,X,−X,+dic(17;17)(p11;p11),+19[cp.3]
      53Presen. F 39 PB NAD 46,XX[10]
      54Presen. F 53 PB NAD 46,XX[10]
      55Presen. M 71 PB NAD46,XY[8]/48,XY,+8,+18[7]
      56 Relapse F 32PB NAD 46,XX[10]
      57 Presen. M 56PB NAD 45,XY,−7[3]
      58 Presen. F 9PB NAD 46,XX[12]/47,XX,+4[5]
      60 Presen.F 43 PB NAD 46,XY[10]
      66 Presen.F 78 PB NAD 46,XX[10]
      71 Presen.F 49 PB NAD 46,XX,der(21)t(?X;21)(q26;q11.2)[10]
      72 Presen. F 65 PB NAD 46,XX[10]
      76 Presen. F 70 PB NAD 46,XX[4]
      79 Presen. M 69 PB NAD 46,XY[12]
      80 Presen. F 48 PB NAD 46,XX[10]
      82 Presen. F 55 PB NAD 46,XX[10]
      83 Presen. F 53 PB NAD 46,XX[10]
      85 Relapse M 71 BM NAD46,XY[2]/45,XY,−7[7]
      86 Remis. M 51PB NAD 46,XY[6]
     144 Presen. F 39 BMNAD 46,XX[8]
     146 Presen. M 63 PBNAD 46,XY[10]
     150 Presen. F 63 PBIns, N/Q cells 46,XX[10]
     179 Presen. M 63PB NAD 47,XY,+8[6]
     183 Presen. M 74PB NAD 46,XY[5]
     184 Presen. M 42 BMNAD 46,XY[10]
     185 Presen. M 73 PBNAD 46,XY[3]
     190 Presen. M 75 PBNAD 46,XX[3] 46,XX,5q-[2]
     195 Presen. F68 PB NAD 47,XX,+4[2]
     201 Presen. M48 PB NAD 46,XY[10]
     210 Presen. M47 PB NAD 46,XY[11]
    D
      30 Presen.F 71 PB NAD ND
      33 Presen. M 74PB Ins. N/Q cells ND
      78 Presen. M 78BM NAD ND
      87 Presen. M 76 PBNAD ND
     116 Presen. F 38 PB NAD ND
     130 Presen. F 72 PB NAD ND
     131Presen. F 38 BM NAD ND
     133 Presen.F 35 PB Ins. N/Q cells ND
     136 Presen.F 75 PB Ins. N/Q cells ND
     140 Presen.F 47 PB Ins. N/Q cells ND
     141 Presen.F 82 BM NAD ND
     153 Presen. F 36PB NAD ND
     155 Presen. M 78 PB NADND
     158 Presen. F 80 BM Ins. N/Q cellsND
     159 Presen. M 77 PB NAD ND
     160 Presen. F 76 BM NAD ND
     164Presen. M 22 PB NAD ND
     169 Presen.F 75 BM NAD ND
     170 Presen. M 57PB NAD ND
     171 Presen. M 79 BM NADND
     178 Presen. F 56 PB NAD ND
    • (A) PCR-positive patients with cytogenetic data; (B) PCR-positive patients with no cytogenetic data; (C) PCR-negative patients with cytogenetic data; (D) PCR-negative patients with no cytogenetic data.

    • Abbreviations: Presen., presentation; Remis., remission; PB, peripheral blood; BM, bone marrow; NAD, no abnormality detected; Ins. N/Q cells, insufficient number or quality of cells; ND, not done.

    • F3-150 Patients for whom both PB and BM samples were analyzed, only 1 has been included in the table.

    • F3-151 RNA was purified at Aarhus University Hospital before this study.

  • Table 5.

    Multiplex RT-PCR and Cytogenetic Data on 62 Pediatric ALL Patients

    UPN Status Diagnose Sex Age (yr) SampleMultiplex RT-PCR Karyotype
    A
      41 RelapseT-ALL M 22 PB t(9;22)(q34;q11)46,XY[1]/46-47,XY,del(7)(q11q21),+8,der(11)t(11;14)(p14;q21),14, +21,del(21)(q21)[cp.8]
      89 Presen. Pre-B-ALLM 2.9 PB dupMLL(11q23)53,XY,+X,+4,+6,+8,+14,+17,+18,+21[co.5]
      90 Relapse Pre-B-ALL M 9 PBt(9;22)(q34;q11) 46,XY[2]/46,XY,del(12)(p11.1p12.1)[3]
      91 Presen. Pre-B-ALL M 3.3 BMt(9;22)(q34;q11) 46,XY[10]
      94 RelapsePre-B-ALL M 3.0 PB t(9;22)(q34;q11)46,XY[4]/46,XY,t(9;22)(q34;q11)[6]
      97 Remis.Pre-B-ALL M 3.4 PB dupMLL(11q23)53-54,XY,+X,+Y,add(5p),+8,add(8p),+10,+14,+21[co.6]
      99 Presen. Pre-B-ALL F 0.6 PBt(10;11)(p12;q23) 46,XX,add(21)(q?22)[1]
     101Presen. Pre-B-ALL M 3.9 PBdupMLL(11q23) 46,XY[10]
     103 RelapsePre-B-ALL M 21 BM dupMLL(11q23)46-47,XY,del(1)(q25),del(8)(q?21.1q?22),del(10)(q24),+20,+21, [c.10]
     108 Remis. Pre-B-ALL M 9 BMdupMLL(11q23) 46,XY[5]
     109 Presen.Pre-B-ALL M 2.7 PB t(12;21)(p13;q22)Failed
     111 Presen. Pre-B-ALL M 2.4PB dupMLL(11q23) 46,XY[5]
     229Presen. Pre-B-ALL F 9 BM t(12;21)(p13;q22)46,X,del(X)(q?25)[3]
     234 Presen. Pre-B-ALLM 5 PB t(4;11)(q21;q23)50-51,XY,+Y,+8,+21,+22[cp.3]
    ?
     243Presen. T-ALL M 1.0 PB t(11;19)(q23;p13.3)46,XY,ins(1)(q21;?)[16]/46,XY,idem,t(14;?)(q11;?)[3]/48,XY, ins(1)(q21;?),+8,+8[3]
     253 Presen. Pre-B-ALL M3.4 PB t(1;19)(q23;p13) Failed
     254Presen. Pre-B-ALL F 4.6 PB t(12;21)(p13;q22)Failed
     256 Presen. Pre-B-ALL F 2.6PB t(1;19)(q23;p13)46,XY[3]/47,XY,−1,+1p-,+1q-[1]
     257 Remis.Pre-B-ALL M 3.3 BM t(1;19)(q23;p13)46,XY[10]
     262 Remis. Pre-B-ALL F 7BM t(6;11)(q27;q23) 46,XX[7]/46,XX,del(6)(q24)[3]
     264 Presen. Pre-B-ALL M 13 BMt(6;11)(q27;q23) Failed
     265 Remis. Pre-B-ALLF 6 BM t(11;19)(q23;p13.1) 46,XX[10]
    B
      93 Presen. Pre-B-ALL M 2.5 PBt(16;21)(p11;q22) ND
     106 Presen. T-ALL F10 BM dupMLL(11q23) ND
     112Presen. ALL M 10 BM dupMLL(11q23)ND
     227 Presen. ALL F 14 PBt(11;19)(q23;p13.1) ND
     238 Presen. Pre-B-ALLF 10 BM t(12;21)(p13;q22) ND
     259Remis. Pre-B-ALL F 5 BM t(6;11)(q27;q23)ND
    C
      95 Presen. Pre-B-ALL M 8PB NAD 46,XY[10]
      96 Presen.Pre-B-ALL F 3.9 PB NAD 46,XX[4]
      98 Relapse ALL M 14 PB NAD46,XY[4]
     102 Presen. T-ALL M 5 PBNAD 46,XY[10]
     110 Presen. Pre-B-ALL M5 BM NAD 46,XY[1]/46,XY,−9,+14,add(14q)[4]
     230 Presen. Pre-B-ALL F 1.5 PB NAD46,XX[10]
     235 Presen. Pre-B-ALL M 5PB NAD46,XY[3]/44-45,XY,3p-,t(4;6)(p16;q?25),−7,−9[cp.3]
     237 Presen. T-ALL F 6 BM NAD46,XX[4]/46,XX,del(6)(q26)[4]/46,XX,del(16)(q23)[2]
     239 Presen. Pre-B-ALL M 2.5 PB NAD46,XY[4]
     241 Presen. Pre-B-ALL M 4.3BM NAD Failed
     242 Presen. Pre-B-ALLM 7 PB NAD Failed
     244 Presen.Pre-B-ALL F 4.3 PB Ins. N/Q cells46,XX[10]
     245 Presen. Pre-B-ALL M 4.7PB Ins. N/Q cells 47,XY,+21[4]/48,XY,+21,+r[2]
     248 Remis. Pre-B-ALL F 5 BM Ins. N/Q cells 46,XX[1]
     249 Presen. Pro-B-ALL M5 PB NAD 46,XY[9]
     250 Presen.T-ALL M 5 BM NAD Failed
     251Presen. Pre-B-ALL M 2.0 PB NAD46,XY[10]
     252 Relapse Pre-B-ALL F 12BM Ins. N/Q cells Failed
     255 Presen.Pre-B-ALL M 5 PB NAD Failed
     258Presen. Pre-B-ALL F 5 PB NAD46,XX[1]/47,XX,+21[3]
     260 Presen. Pre-B-ALLM 3.7 BM Ins. N/Q cells Failed
     261Presen. Pre-B-ALL M 4.3 BM NAD Failed
     263 Presen. Pre-B-ALL F 6 BM NAD46,XX[6]
    D
      88 Presen. Pre-B-ALLF 4.8 PB NAD ND
      92 Remis.Pre-B-ALL M 7 BM NAD ND
     100Relapse Pre-B-ALL M 14 PB NAD ND
     107 Presen. Pre-B-ALL F 6 PB NADND
     228 Presen. Pre-B-ALL M 3.3 PBNAD ND
     231 Presen. Pre-B-ALL F 7PB NAD ND
     232 Presen. Pre-B-ALL M2.2 BM NAD ND
     236 Presen. Pre-B-ALLF 3.2 PB NAD ND
     246 RelapsePre-B-ALL F 5 BM NAD ND
     247Presen. Pre-B-ALL M 1.7 PB Ins. N/Q cellsND
     320 Presen. Pre-B-ALL F 2.7 BMNAD ND
    • (A) PCR-positive patients with cytogenetic data; (B) PCR-positive patients with no cytogenetic data; (C) PCR-negative patients with cytogenetic data; (D) PCR-negative patients with no cytogenetic data. Cytogenetically t(9;22)(q34;q11)[10] at diagnosis. Abbreviations and notes are as in Table 4.

  • Table 6.

    Summary of Aberrations in AML and ALL Patients Detected by Multiplex RT-PCR and Cytogenetic Analysis

    Aberration Multiplex PCRCytogenetic
    AML ALL AML ALL
    t(1;19)(q23;p13) 0/102 3/62 0/66 0/45
    t(2;5)(p23;q35) 1/102 0/62 0/66 0/45
    t(4;11)(q21;q23) 0/102 1/62 0/66 0/45
    t(6;9)(q23;q34) 2/102 0/62 1/66 0/45
    t(6;11)(q27;q23) 2/102 3/62 0/66 0/45
    t(8;21)(q22;q22) 8/102 0/62 2/66 0/45
    t(9;11)(q22;q23) 1/102 0/62 0/66 0/45
    t(9;22)(q34;q11) 3/102 4/62 0/66 1/45
    t(10;11)(p12;q23) 2/102 1/62 2/66 0/45
    dupMLL(11q23) 12/102 8/62
    t(11;19)(q23;p13.1) 1/102 2/62 0/660/45
    t(11;19)(q23;p13.3) 0/102 1/62 0/66 0/45
    t(12;21)(p13;q22) 0/102 4/62
    t(15;17)(q21;q22) 7/102 0/62 2/66 0/45
    inv(16)(p13q22) 6/102 0/62 2/66 0/45
    t(16;21)(p11;q22) 0/102 1/62 0/66 0/45
    Patients with numerical aberrations 17/6611/45
    Patients with chromosomal aberrations 45/10228/62 29/66 17/45