SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Yu, L.-C. Articles by Lin, M. Search for Related Content PubMed PubMed Citation Articles by Yu, L.-C. Articles by Lin, M. Related Collections Red Cells Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 15 December 2001, Vol. 98, No. 13, pp. 3840-3845 RED CELLS Molecular basis of the adult i phenotype and the gene responsible for the expression of the human blood group I antigen Lung-Chih Yu, Yuh-Ching Twu, Ching-Yi Chang, and Marie Lin From the Transfusion Medicine Laboratory, Department of Medical Research, and the Immunohematology Reference Laboratory, Mackay Memorial Hospital, Taipei, Taiwan.     Abstract Top Abstract Introduction Materials and methods Results Discussion References The human blood group i and I antigens are characterized as linear and branched repeats of N-acetyllactosamine, respectively. Conversion of the i to the I structure requires the activity of I-branching -1,6-N-acetylglucosaminyltransferase (IGnT). Thus the blood group I gene is assigned to encode a -1,6-N-acetylglucosaminyltransferase; however, its identity has not been confirmed. The null phenotype of I, the adult i phenotype, provides a means to identify the I gene. Interestingly, the adult i phenotype has been noted to be associated with congenital cataracts in Asians. Molecular genetic studies of 3 adult i pedigrees are reported here. The results obtained on mutation detection within the 2 I-branching enzyme encoding genes, segregation analyses, and enzyme function assays identify molecular changes associated with the adult i phenotype. The adult i phenotype in 2 of the pedigrees studied resulted from 1043GA and 1148GA mutations, which predict Gly348Glu and Arg383His alterations, respectively, in the IGnT gene. These amino acid changes abolished the original GlcNAc-transferase activity. Deletion of the IGnT gene was observed in the person with adult i phenotype in the third pedigree. These findings suggest that the IGnT gene, first reported in 1993, is the candidate for the blood group I gene. Confirmation of the blood group I gene will further assist in the investigations of the molecular genetics that control I antigen expression in secretions and the molecular basis for the association of the adult i phenotype with congenital cataracts in Asians. (Blood. 2001;98:3840-3845) © 2001 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References In 1956, Wiener et al1 first gave the name I to an antigen detected by a cold agglutinating autoantibody called anti-I. They found that red blood cells (RBCs) of only a small percentage of persons (5 of 22 000) were nonreactive to anti-I, and this phenotype was called I-negative. Later studies found that cord blood cells contained a very weak I antigen.2,3 In 1960, Marsh and Jenkins4 described the first cold agglutinating antibody, named anti-i, which behaved in an opposite manner to anti-Ireacting strongly with cord blood cells and RBCs with the I-negative phenotype but weakly with normal adult RBCsand thus established the i antigen.5,6 Expression of the I and i antigens was soon found to have a reciprocal relationship and to be developmentally regulated. Adult human RBCs fully express I antigen and contain only a few i antigens, whereas the i antigen is predominantly present on fetal and neonatal RBCs. After birth, the quantity of I antigen gradually increases as the i antigen decreases, until the normal Ii status of adult RBCs is reached after approximately 18 months of life.5,6 Like ABH antigens, Ii antigens are also referred to as histo-blood group antigens7 because they are detected not only on RBCs but also on the surfaces of most human cells and on soluble glycoproteins in various body fluids, including saliva,8 plasma,8 milk,9 amniotic fluid, urine, and ovarian cyst fluid.10 The developmentally regulated expression of Ii antigens is exhibited on RBCs and in many other tissues. High expression of the i antigen has been shown to be characteristic of immature and less differentiated cells.7 Altered expression patterns of I and i antigens have often been observed during oncogenesis processes,11 and thus the Ii antigens are considered as onco-developmental antigens.12 The Ii antigenic determinants have been elucidated through various studies.13-16 They are carbohydrate structures carried on glycolipids and glycoproteins and are present on the interior structures of the complex carbohydrate chains bearing ABH and Lewis antigens. Based on type 2 Gal1-4GlcNAc chains, the basic i and I structures are characterized as linear and branched repeats of N-acetyllactosamine, Gal1-4GlcNAc1-3Gal1-4GlcNAc-R, and Gal1-4GlcNAc1-3(Gal1-4GlcNAc1-6)Gal1-4GlcNAc-R, respectively (Figure 1). The N-acetyllactosamine repeats are synthesized by the sequential action of -1,3-N-acetylglucosaminyltransferase and -1,4-galactosyltransferase. Conversion of i antigen into an I-active structure requires the activity of a third enzyme, the I-branching -1,6-N-acetylglucosaminyltransferase (6GlcNAc-T).14,16,17 Thus the blood group I locus is assigned to encode a 6GlcNAc-T. The reciprocal relationship of i- and I-antigen expression is believed to result from the appearance of the active I-branching enzyme after birth. However, I and i antigens cannot be considered products of alleles because the i antigen is determined by the action of -1,3-N-acetylglucosaminyltransferase and -1,4-galactosyltransferase. Consequently, the Ii antigens do not satisfy the criteria for designation as a blood group system and are categorized to comprise collection 207 according to the International Society of Blood Transfusion terminology. View larger version (28K): [in this window] [in a new window]   Figure 1. Structures and biosynthetic pathways of the i and I antigens. The i antigen is characterized by a linear chain of repeating N-acetyllactosamine units and is converted to the branched I antigenic structure through the activity of I-branching -1,6-N-acetylglucosaminyltransferase. In 1993, Bierhuizen et al18 reported the expression cloning of a cDNA encoding an I-branching 6GlcNAc-T. The gene, designated IGnT, is located on chromosome 6p24.19,20 Another gene, located on chromosome 15q21-22 and designated C2GnT-M19 or C2/4GnT,20 was identified and shown to encode another I-branching-forming enzyme.19 The blood group I locus has not been confirmed to date because more than one I-branching 6GlcNAc-T, coded by different loci, has been identified, and it is thought there may be other 6GlcNAc-Ts still awaiting elucidation. The adult i phenotype should provide a means of demonstrating the gene responsible for blood group I antigen expression. Similar investigations have been of great value in confirming the identities of several blood group genesamong them Lewis,21 Secretor,22 and Pk,23as those responsible for controlling their respective blood group antigen expression. Like fetal RBCs and cord cells, RBCs of persons with adult i phenotype are rich in i antigen but contain little I antigen. The phenotype is inherited as an autosomal recessive trait and is believed to result from lack of I-branching transferase activity.15,16 The frequency of the adult i phenotype is low, with only few occurrences in thousands or tens of thousands.10 Despite its rareness, the adult i phenotype has attracted considerable attention because of its association with congenital cataracts. Yamaguchi et al24-26 first reported the observation of an association between the adult i phenotype and congenital cataracts among Japanese. Linkage of adult i phenotype and congenital cataracts has been observed in 3 Taiwanese pedigrees.27 However, the association does not seem to be as pronounced in the white population.28-30 Molecular genetic analysis of the adult i phenotype may provide a means of identifying the blood group I gene, but it also may facilitate progress in uncovering the basis for the association of the adult i phenotype with a frequent occurrence of congenital cataracts in Asians. Three Taiwanese adult i pedigrees were previously identified27; the 5 members with adult i phenotype all have congenital cataracts, whereas none of the other 17 members with I phenotype do. In this report we describe the findings of molecular genetic studies of these 3 pedigrees, in which the 2 reported I-branching 6GlcNAc-T encoding genes, IGnT and C2GnT-M, were targeted.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Samples Three adult i pedigrees (pedigrees S, W, and C), including 5 members with adult i phenotype, the rest of the members with common I phenotype, and 51 randomly selected controls served as the study subjects. Informed consent was obtained from all participants. Identification of the 3 families has been reported.27 Before the current studies, the Ii phenotypes of the members in the 3 families were confirmed by a tube method using anti-I antibody (a gift from Dr Y. Okubo, Red Cross Blood Center, Osaka, Japan). Total RNA and genomic DNA from these persons were prepared from their peripheral blood cells using the QIAamp RNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany) and the QIAamp DNA Blood Mini Kit (Qiagen), respectively. Reverse transcription-polymerase chain reaction and cloning of the IGnT and C2GnT-M genes Complementary DNA (cDNA) to the IGnT transcript was amplified from the RNA sample by reverse transcription-polymerase chain reaction (RT-PCR) using the OneStep RT-PCR Kit (Qiagen) and the synthetic oligonucleotide primer pair of IFb (AACAGGGCAGGAGTGAGTGGAGTATGTTGC, nucleotides 117 through 88 of IGnT cDNA, codon for initiation methionine as nucleotides 1-3) and IRc (AGCTGCAGTTTCCCTTCAGTCATGAGTAGC, complementary of nucleotides 1215-1244). Then 1.5 µg total RNA and 15 pmol each primer were combined in a final volume of 25 µL RT-PCR master mix and were subjected to an RT-PCR program consisting of 30 minutes at 50°C and then 15 minutes at 95°C followed by 40 cycles of 1 minute at 94°C and 2.5 minutes at 72°C. The coding sequence of the C2GnT-M gene is located in a single exon and, therefore, could be amplified from genomic DNA by PCR. One hundred nanograms genomic DNA and 10 pmol each primer, MF1 (GGATTGTGTCCTCCTCCACCTTCCCTGTGC, nucleotides 61 through 32 of C2GnT-M, codon for initiation methionine as nucleotides 1-3) and MR3 (CCACCCACACTGTCCCAGCAAGTTCTGAGC, complementary to nucleotides 1369-1398), were combined in PCR buffer containing 0.2 mM dNTP and 0.5 U hot-start Taq polymerase (Qiagen). The PCR program included 15 minutes at 95°C followed by 30 cycles of 1 minute at 94°C and 2.5 minutes at 72°C. PCR products of 1361 bp and 1459 bp, encompassing the coding regions of IGnT and C2GnT-M, respectively, were cloned into the pCRII-TOPO vectors using a TOPO TA Cloning Kit (Invitrogen, Groningen, The Netherlands), and DNA sequences were determined using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). Multiple clones from 2 batches of PCR products were sequenced to distinguish any PCR error from actual sequence polymorphism. RT-PCR for the -actin cDNA was performed using the same OneStep RT-PCR Kit (Qiagen) and the primers with sequences of CCTCGCCTTTGCCGATCC and GGATCTTCATGAGGTAGTCAGTC (antisense). The RT-PCR program was similar to that described above, except that annealing occurred at 55°C for 1 minute and extension at 72°C for 1 minute. PCR amplifications of the 3 exon regions of the IGnT gene were achieved by using primer pairs of IFb and IRd (CCTAATAAAAAGTGGCTGGTTATTCTAAAGCC, antisense sequence, 50 nucleotides downstream of exon 1), IFh (TCCCTTCTCTCATGACTCTCATCTCTACGC, 22 nucleotides upstream of exon 2) and IRk (ACACCAACAGGCAGCGGCCT-AGAAGCATGG, antisense sequence, 14 nucleotides downstream of exon 2), and IFg (GTCGGAGAGTACCTCTAGTATTCTGTAAGTTC, 57 nucleotides upstream of exon 3) and IRc. PCR conditions were similar to those described above, except that annealing occurred at 60°C for 1 minute and extension at 72°C for 1 minute. PCR-sequence specific primer-restriction fragment length polymorphism analysis A PCR-sequence specific primer (SSP) conjoining the restriction fragment length polymorphism (RFLP) method was developed to detect the 1043GA and 1148GA mutations identified in the IGnT alleles. Wild-type and mutant oligonucleotide primers, w (GGTATTTGTATCTATGGA) and m (GGTATTTGTATCTATGAA), were designed and annealed to the IGnT gene with wild-type G nucleotide at position 1043 and to the mutant Ii1 allele with A nucleotide at position 1043 under appropriate temperatures, respectively. One hundred nanograms genomic DNA and 10 pmol each forward (w or m) and reverse (IRc) primer were combined in PCR buffer containing 0.2 mM dNTP and 0.5 U hot-start Taq polymerase. The PCR program included 15 minutes at 95°C followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 54°C (for w+IRc primers) or 50°C (for m+IRc primers), and 30 seconds at 72°C. The amplified 218-bp fragment encompasses the 1148 nucleotide position. As the 1148GA mutation of the mutant Ii2 allele destroys a BstUI recognition sequence (CGCG), the PCR products were subjected to digestion by BstUI restriction endonuclease and then were analyzed by 2.0% agarose gel electrophoresis. The 218-bp PCR product amplified from the allele with wild-type 1148 nucleotide was cleaved into 122- and 96-bp fragments by BstUI digestion, whereas that from the mutant allele with 1148GA mutation was resistant to digestion. Functional analyses of the wild-type and mutant IGnT genes cDNA fragments encompassing the region of nucleotides 88 to 1200, which encode the amino acid residues 30 to 400, of the I, Ii1, and Ii2 genes were prepared using the OneStep RT-PCR Kit (Qiagen) and primers of IFw (aattggcccagccggccGATCCAAGCTTCCAAAGGCTAAATATC) and IRx (ttaagggcccAAAATACCAGCTGGGTTGTATCGCAG, antisense sequence), which contained SfiI and ApaI recognition sequences (underlined) at their 5' ends, respectively. Total RNAs obtained from W-1 and W-2 members of pedigree W served as templates. Amplified cDNA fragments were cloned into SfiI and ApaI sites of the mammalian expression vector pSecTaq2A (Invitrogen), which is designed for the secretion of the expressed protein by the N-terminal secretion signal from the V-J2-C region of mouse immunoglobulin  chain. Vectors bearing wild-type I, Ii1, and Ii2 cDNAs were selected and sequence-confirmed, leading to the construction of pSecTaq2A-I, pSecTaq2A-Ii1, and pSecTaq2A-Ii2, respectively. The 3 constructed and the mock pSecTaq2A plasmids were prepared for transfection using the EndoFree Plasmid Kit (Qiagen). COS-7 cells (purchased from the American Type Culture Collection, Manassas, VA) were grown in 90% Dulbecco modified eagle medium and 10% fetal bovine serum containing 50 U/mL penicillin and 50 µg/mL streptomycin. The day before transfection, cells were split into 60-mm culture dishes at a density of 5 × 104/mL; after culture for 24 hours, cells were transfected with 1 µg expression vector. Transfection of the cells was performed using Effectene Transfection Reagent (Qiagen). After culture for an additional 72 hours, the medium was harvested and then concentrated 50-fold by Centriplus YM-10 (Millipore Intertech, Bedford, MA) and directly used for GlcNAc-transferase assay. The GlcNAc-transferase assay was performed in a 25-µL reaction mixture containing 50 mM cacodylic acid (sodium salt, pH 7.0), 20 mM MnCl2, 4 mM ATP, 10 mM D-galactonic acid -lactone, 1 mM EDTA, 0.5 mM UDP-GlcNAc, 0.25 µCi (9250 Bq) UDP-[3H]GlcNAc (60 Ci/mmol; American Radiolabeled Chemicals, St Louis, MO), 7.5 µL concentrated medium, and with or without 2 mM acceptor substrate, LS-tetrasaccharide c (NeuNAc2-6Gal1-4GlcNAc1-3Gal1-4Glc; Oxford GlycoSystems, Abingdon, United Kingdom). After incubation at 37°C for 2.5 hours, the reaction mixtures were passed through a mixed bed of AG1-X8 (AcO) and AG50W-X8 (H+) resins (Bio-Rad Laboratories, Hercules, CA), and the run-through was scintillation-counted.     Results Top Abstract Introduction Materials and methods Results Discussion References Missense mutations were identified in the IGnT gene, but not in the C2GnT-M gene, of adult i propositi The coding regions of the IGnT and C2GnT-M of the adult i propositus, member 6 of pedigree S (denoted as S-6), were amplified and cloned, and the sequences were determined. Eight IGnT clones from the S-6 propositus were analyzed, and all were found to have a nucleotide substitution of G to A at position 1043, which predicts an amino acid alteration of Gly to Glu at residue 348 (Figure 2). Direct sequencing of the RT-PCR product of IGnT cDNA also demonstrated the 1043GA substitution. Taken together, these results suggest that the S-6 propositus was most likely homozygous for the 1043GA mutation in the IGnT gene. Analysis of sequences of 4 C2GnT-M clones from S-6 revealed nucleotide substitutions in these clones, but none had identical mutations. Direct sequencing of the PCR product of the C2GnT-M gene yielded the expected sequence of the wild-type gene and suggested that the mutations in the clones were due to PCR errors. These results support the proposition that the C2GnT-M gene of the adult i propositus (S-6) had a wild-type coding sequence. View larger version (10K): [in this window] [in a new window]   Figure 2. Schematic representation of the mutations identified in the IGnT genes of persons with adult i phenotype. I indicates the coding region of the IGnT gene reported by Bierhuizen et al18 in 1993. ATG and TGA correspond to the enzyme's translation initiation and termination codons, respectively. Mutant alleles identified in the persons with adult i phenotype, designated as Ii1 and Ii2, had 1043GA and 1148GA nucleotide substitutions, respectively, which predict amino acid alterations of Gly348Glu and Arg383His, respectively. The IGnT gene of another adult i propositus, member 3 of pedigree W (denoted as W-3), was also analyzed. Three of the 5 IGnT clones from this propositus also demonstrated the 1043GA substitution; however, the other 2 had the wild-type G nucleotide at position 1043 and another nucleotide substitution of G to A at position 1148. This substitution led to an amino acid change of Arg to His at residue 383 (Figure 2). Her parents were further analyzed, and both were shown to be heterozygotes at the IGnT locus. The IGnT allele with 1043GA mutation was demonstrated in the mother, and the IGnT with the 1148GA mutation was demonstrated in the father. Both parents had another IGnT allele with a wild-type coding sequence identical to that previously reported.18 The identified mutant IGnT alleles with the 1043GA and 1148GA mutations and their corresponding amino acid changes are illustrated in Figure 2 and are designated as Ii1 and Ii2, respectively. The wild-type allele is indicated as I. Linkage of double-dose mutant IGnT alleles with i members, but not with I members, in the 2 pedigrees A PCR-SSP-RFLP analysis was developed to detect the mutations of the Ii1 and Ii2 alleles. By using the plasmid clones bearing the wild-type I, Ii1, and Ii2 cDNA segments as control templates, the system showed specificity in distinguishing the 3 alleles (Figure 3A-B, lower panels). The wild-type I allele yielded a PCR product when the wild-type primer set (w+IRc) was used, but not when the mutant primer set (m+IRc) was used. The amplified 218-bp fragment was cleaved to 122- and 96-bp products by BstUI digestion. PCR product was produced from the Ii1 allele only when the mutant primer set was used. The product was also cleaved into 122- and 96-bp fragments by BstUI. The Ii2 allele yielded 218-bp product from wild-type primer, and the fragment was resistant to the BstUI digestion because of the 1148GA mutation. View larger version (22K): [in this window] [in a new window]   Figure 3. Segregation of wild-type I, Ii1, and Ii2 alleles in 2 adult i pedigrees. Pedigree drawings (upper) and PCR-SSP-RFLP analysis of the family members (lower) of pedigree S (A) and pedigree W (B). Pedigree drawing: To avoid confusing the blood group I phenotype and the I gene, the standard symbols for generations I, II, and III, are not used. Open and solid symbols for male (square) and female (circle) denote an person with common I and adult i phenotypes, respectively. I locus genotypes under each symbol are inferred from the results of PCR-SSP-RFLP analysis for each person. The adult i propositus in each pedigree is indicated by an arrow. Samples from S-1 and S-3 were unavailable in the current study to determine their I genotype; however, these persons were previously demonstrated to have I phenotype.27 PCR-SSP-RFLP analysis: w and m represent the PCR amplifications using the wild-type primer set and mutant primer set, respectively, for distinguishing the I and Ii1 alleles (described in "Materials and methods" and "Results"). The 218-bp PCR products were then digested with BstUI restriction endonuclease for distinguishing the I and Ii2 alleles. Plasmid clones bearing I, Ii1, and Ii2 cDNA segments served as control templates. The results for the third generation of pedigree S, S-9 to S-12, are not shown. Lane M shows the molecular mass standards of the 100-bp ladder. Using this method, the I locus genotypes of the members of pedigrees S and W were demonstrated. As shown in Figure 3A, another adult i member of the pedigree S, S-7, was demonstrated to be homozygous for the Ii1 allele, as had been shown for the S-6 propositus. All the other members were I phenotype and had at least one wild-type I allele, having either I/I or I/Ii1 genotypes. In the pedigree W, the Ii1/Ii2 genotype was also demonstrated in another i member, W-5 (Figure 3B). Her sister, W-4, was a heterozygote with the I/Ii1 genotype and had the common I phenotype. The father and mother had I/Ii2 and I/Ii1 genotypes, respectively, as demonstrated by cloning and PCR-SSP-RFLP analyses. Obviously the heterozygous Ii1/Ii2 genotype of the W-3 and W-5 i adults resulted from the segregation of the mutant IGnT alleles from her mother and father with their respective 1043GA and 1148GA mutations. Results obtained from the 2 pedigrees show the correlation of segregation of double-dose mutant IGnT alleles, Ii1 and Ii2, with the formation of the adult i phenotype. The Ii1 and Ii2 mutant alleles are rare in the general population The PCR-SSP-RFLP method was used to inspect the incidence of the Ii1 and Ii2 alleles in the general population. Genomic DNA obtained from 51 randomly selected persons were screened, and none of them had the mutations of 1043GA or 1148GA in their IGnT genes (data not shown). The result indicates that the Ii1 and Ii2 alleles are infrequent, and agrees with the observation of rareness of the adult i phenotype. Deletion of the IGnT gene was observed in a person with adult i phenotype A different molecular basis for the adult i phenotype was observed in the pedigree C (Figure 4). RT-PCR of peripheral blood cell RNA of the member with adult i phenotype (C-3) failed to amplify the IGnT cDNA (Figure 4B). However, RNA samples from other members with I phenotype, C-1, C-2, and C-4, yielded products of IGnT cDNA. Each of the 3 exon regions of the IGnT gene of the families was examined by PCR. PCR products with the expected sizes for IGnT exon 1, exon 2, and exon 3 regions were produced from genomic DNA samples of the 3 I members, whereas genomic DNA sample of C-3 failed to yield any product for the IGnT exon regions (Figure 4C). The -actin and the C2GnT-M genes served as controls for the RT-PCR and PCR reactions, respectively, and demonstrated the integrity of RNA and genomic DNA samples of C-3. View larger version (24K): [in this window] [in a new window]   Figure 4. Deletion of I gene in the i member of pedigree C. (A) Pedigree drawing. A sample from C-5 was unavailable in the current study; however, she had been shown to have common I phenotype previously.27 The parents were first cousins. (B) RT-PCR for I cDNA. The expected size of the RT-PCR product of I cDNA is 1361 bp. Lane M shows the molecular mass standards of the 100-bp ladder. (C) PCR amplifications for the 3 exon regions of the I gene. PCR amplifications for the DNA segments, including I exon 1 (1118 bp), I exon 2 (189 bp), and I exon 3 (321 bp), and C2GnT-M gene (1459 bp), which served as control, were performed separately, and then the 4 products from each person's sample were analyzed in the same lane. The results showed that the chromosome region of the IGnT gene was totally absent in the C-3 i adult but appeared intact (at least for one allele) and was expressed normally in the other I members. This evidence further supports that the IGnT gene is responsible for the expression of blood group I antigen. Enzyme activity of the I 6GlcNAc-T is abolished by the Gly348Glu and Arg383His alterations The effects of the Gly348Glu and Arg383His changes, resulting from the 1043GA and 1148GA mutations, respectively, on the enzyme activity of I 6GlcNAc-T were inspected and compared using a functional assay. Table 1 lists the amounts of GlcNAc transferred to the acceptor substrate, LS-tetrasaccharide c, from the donor substrate UDP-GlcNAc by the medium concentrates harvested from the cells transfected with the respective expression vectors. LS-tetrasaccharide c has been shown to be a good acceptor substrate for 6GlcNAc-T transferase assay.31 Medium harvested from the cells transfected with the expression vector bearing the wild-type I cDNA segment displayed GlcNAc-transferring activity in the assay. In contrast, medium from the cells transfected with vectors constructed with the Ii1 and Ii2 cDNAs, respectively, had virtually no detectable activity because the amounts of GlcNAc transferred were at the same level as the mock control pSecTaq2A. These findings indicate that the Gly348Glu or Arg383His alterations in I 6GlcNAc-T totally abolished the original GlcNAc-transferase activity.                                View this table: [in this window] [in a new window]   Table 1. Comparison of the GlcNAc-transferase activities of the enzymes expressed from the I, Ii1, and Ii2 cDNAs     Discussion Top Abstract Introduction Materials and methods Results Discussion References Molecular genetic analyses of the 3 adult i pedigrees demonstrated 3 different molecular origins for the adult i phenotype and suggest that the IGnT gene is the locus responsible for the expression of the human blood group I antigen. Although the I antigen was first identified more than 40 years ago, it is one of the few human blood groups for which the responsible gene locus remains unconfirmed. Even though the IGnT gene has been identified and its protein product was demonstrated several years ago to have I-branching forming capability, it has not been approved as the human blood group I gene because it is believed that more than one I-branching enzymes may exist. It has been suggested that different I-branching enzymes may be responsible for the synthesis of I antigens in different tissues.10 The identification of another I-branching enzyme encoding gene, C2GnT-M, has further complicated efforts to identity the blood group I gene, though it is not surprising that another I-branching GlcNAc-T exists. Therefore, further evidence from the genetic analysis of the null phenotype of the I blood group, the adult i phenotype, has been awaited to confirm the identity of the human blood group I gene.32 The current study has provided this evidence. The IGnT gene, identified by Bierhuizen et al18 in 1993, encodes a 6GlcNAc-T enzyme composed of 400 amino acid residues. The gene is located on chromosome 6p24,19,20 and its 1200 nucleotides of coding sequence are divided into 3 exon regions.33 Two possible enzymatic pathways have been proposed for I-branching activity: centrally acting34,35 and distally acting.17 Through enzyme characterization using different acceptor substrates, the 6GlcNAc-T encoded by the IGnT gene was shown to have a majority of centrally acting activity, transferring GlcNAc to the internal Gal in Gal1-4GlcNAc1-3Gal1-4GlcNAc1-R sequence, and a minority of distally acting activity, transferring GlcNAc to predistal Gal in the acceptor GlcNAc1-3Gal1-4GlcNAc1-R.19,36 Confirmation of the I gene locus will allow further investigation of the gene regulation mechanism(s) for differential expression of I antigen during developmental and oncogenesis processes, and it will further assist in the investigations of the molecular genetics that control I antigen expression in secretions and the molecular basis for the association of the adult i phenotype with congenital cataracts in Asians. Synthesis of I antigens in different tissues has been suggested to result from different I-branching enzymes given that normal quantities of I antigen in saliva, milk, and plasma of persons with adult i phenotype has been observed.37,38 A similar situation has been demonstrated in the formation of blood group H antigens in RBC membrane and in saliva, which are synthesized by the action of different -1,2-fucosyltransferases encoded by the H and Secretor genes, respectively.39 Whether the other I-branching enzyme encoding gene, C2GnT-M, or another unidentified gene is responsible for the I antigen expression in secretions remains to be determined. Identification of the molecular origins of the adult i phenotype in the 3 pedigrees still leaves the molecular genetic basis of its association with congenital cataracts in Asians obscure for the present. The association can be explained by either a close linkage between independent I- and cataract-related genes or a pleiotropic effect of the gene responsible for the adult i phenotype on the development of cataracts.24,25 Because of the reduced association between adult i phenotype and congenital cataracts in the white population, the former hypothesis of a close linkage of 2 independent genes was suggested to be the tenable one.28 It has been proposed that the adult i phenotype in Asians, and in some whites, may result from the deletion of a small chromosomal region that also encompasses a nearby gene, and this results in the development of cataracts.10 In our study, chromosomal deletion was detected in one person with adult i in 1 of our 3 pedigrees; however, the molecular basis of the adult i phenotype in the other 2 pedigrees consisted of single nucleotide substitutions in the I gene that occurred at 2 different positions. It is unlikely that 2 different mutational changes would be linked to the same nearby gene that had, by chance, also mutated to a form that resulted in the development of cataracts. Elucidation of the molecular genetic basis of persons with adult i without congenital cataracts may help explain the association in Asians.     Footnotes Submitted June 11, 2001; accepted August 13, 2001. Supported in part by National Health Research Institute grant NHRI-EX90-8601SL (M.L.) and National Science Council grant NSC 89-2314-B-195-014 (L.-C.Y.) Nucleotide sequences reported in this paper have been submitted to the GenBank/EBI Data Bank with accession numbers AF401652 and AF401653. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Marie Lin, Transfusion Medicine Laboratory, Mackay Memorial Hospital, 45 Ming-San Rd, Tamshui, Taipei County 251, Taiwan; e-mail: marilin{at}ms2.mmh.org.tw.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Wiener AS, Unger LJ, Cohen L, Feldman J. Type-specific cold auto-antibodies as a cause of acquired hemolytic anemia and hemolytic transfusion reactions: biological test with bovine red cells. Ann Intern Med. 1956;44:221-240. 2. Jenkins WJ, Marsh WL, Noades J, Tippett P, Sanger R, Race RR. The I antigen and antibody. Vox Sang. 1960;5:97-106. 3. Tippett P, Noades J, Sanger R, et al. Further studies of the I antigen and antibody. Vox Sang. 1960;5:107-121. 4. Marsh WL, Jenkins WJ. Anti-i: a new cold antibody [commentary]. Nature (London). 1960;188:753[Medline] [Order article via Infotrieve]. 5. Marsh WL. Anti-i: a cold antibody defining the Ii relationship in human red cells. Br J Haematol. 1961;7:200-209. 6. Marsh WL, Nichols ME, Reid ME. The definition of two I antigen components. Vox Sang. 1971;20:209-217[Medline] [Order article via Infotrieve]. 7. Clausen H, Hakomori S. ABH and related histo-blood group antigens: immunochemical differences in carrier isotypes and their distribution. Vox Sang. 1989;56:1-20[Medline] [Order article via Infotrieve]. 8. Rouger P, Juszczak G, Doinel C, Salmon C. Relationship between I and H antigens, I: a study of the plasma and saliva of a normal population. Transfusion. 1980;20:536-539[CrossRef][Medline] [Order article via Infotrieve]. 9. Marsh WL, Nichols ME, Allen FH. Inhibition of anti-I sera by human milk. Vox Sang. 1970;18:149-154[Medline] [Order article via Infotrieve]. 10. Daniels G. Human Blood Groups. Oxford, England: Blackwell Science; 1995. 11. Hakomori S, Kannagi R. Glycosphingolipids as tumor-associated and differentiation markers. J Natl Cancer Inst. 1983;71:231-251. 12. Feizi T. Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature (London). 1985;314:53-56[CrossRef][Medline] [Order article via Infotrieve]. 13. Neimann H, Watanabe K, Hakomori S, Childs RA, Feizi T. Blood group i and I activities of `lacto-N-nor-hexaosylceramide' and its analogues: the structural requirements for i-specificity. Biochem Biophys Res Commun. 1978;81:1286-1293[CrossRef][Medline] [Order article via Infotrieve]. 14. Watanabe K, Hakomori S, Childs RA, Feizi T. Characterization of a blood group I-active ganglioside. J Biol Chem. 1979;254:3221-3228[Free Full Text]. 15. Koscielak J, Zdebska E, Wilczynska Z, Miller-Podraza H, Dzierzkowa-Borodej W. Immunochemistry of Ii-activity glycosphingolipids. Eur J Biochem. 1979;96:331-337[Medline] [Order article via Infotrieve]. 16. Fukuda M, Fukuda M, Hakomori S. Developmental change and genetic defect in the carbohydrate structure of band 3 glycoprotein of human erythrocyte membrane. J Biol Chem. 1979;254:3700-3703[Abstract/Free Full Text]. 17. Piller F, Cartron J-P. Biosynthesis of blood group I antigens. J Biol Chem. 1984;259:13385-13390[Abstract/Free Full Text]. 18. Bierhuizen MFA, Mattei M-G, Fukuda M. Expression of the developmental I antigen by a cloned human cDNA encoding a member of a -1,6-N-acetylglucosaminyltransferase gene family. Genes Dev. 1993;7:468-478[Abstract/Free Full Text]. 19. Yeh J-C, Ong E, Fukuda M. Molecular cloning and expression of a novel -1,6-N-acetylglucosaminyltransferase that forms core 2, core 4, and I branches. J Biol Chem. 1999;274:3215-3221[Abstract/Free Full Text]. 20. Schwientek T, Nomoto M, Levery SB, et al. Control of O-glycan branch formation. J Biol Chem. 1999;274:4504-4512[Abstract/Free Full Text]. 21. Mollicone R, Reguine I, Kelly RJ, et al. Molecular basis for Lewis (1,3/1,4)-fucosyltransferase gene deficiency (FUT3) found in Lewis-negative Indonesian pedigrees. J Biol Chem. 1994;269:20987-20994[Abstract/Free Full Text]. 22. Kelly RJ, Reguine S, Giorgi D, Lennon GG, Lowe JB. Sequence and expression of a candidate for the human Secretor blood group (1,2)fucosyltransferase gene (FUT2). J Biol Chem. 1995;270:4640-4649[Abstract/Free Full Text]. 23. Steffensen R, Carlier K, Wiels J, et al. Cloning and expression of the histo-blood group Pk UDP-galactose: Gal1-4Glc1-Cer 1,4-galactosyltransferase. J Biol Chem. 2000;275:16723-16729[Abstract/Free Full Text]. 24. Yamaguchi H, Okubo Y, Tanaka M. A note on possible close linkage between the Ii blood locus and a congenital cataract locus. Proc Japan Acad. 1972;48:625-628. 25. Ogata H, Okubo Y, Akabane T. Phenotype i associated with congenital cataract in Japanese. Transfusion. 1979;19:166-168[CrossRef][Medline] [Order article via Infotrieve]. 26. Okubo Y, Yamaguchi H. I-negative phenotype and cataract. In: Program and abstracts of the XIX Congress of the International Society of Blood Transfusion; 1986; Sydney, Australia. Abstract 147. 27. Lin-Chu M, Broadberry RE, Okubo Y, Tanaka M. The i phenotype and congenital cataracts among Chinese in Taiwan [letter]. Transfusion. 1991;31:676-677[Medline] [Order article via Infotrieve]. 28. Marsh WL, DePalma H. Association between the Ii blood group and congenital cataract. Transfusion. 1982;22:337-338[CrossRef][Medline] [Order article via Infotrieve]. 29. Macdonald EB, Douglas R, Harden PA. A Caucasian family with the i phenotype and congenital cataracts. Vox Sang. 1983;44:322-325[Medline] [Order article via Infotrieve]. 30. Page PL, Langevin S, Petersen RA, Kruskall MS. Reduced association between the Ii blood group and congenital cataracts in white patients. Am J Clin Pathol. 1987;87:101-102[Medline] [Order article via Infotrieve]. 31. Chen GY, Kurosawa N, Muramatsu T. A novel variant form of murine -1,6-N-acetylglucosaminyltransferase forming branches in poly-N-acetyllactosamines. Glycobiology. 2000;10:1001-1011[Abstract/Free Full Text]. 32. Issitt PD, Anstee DJ. Applied Blood Group Serology. Durham, NC: Montgomery Scientific Publications; 1998. 33. Bierhuizen MFA, Maemura K, Kudo S, Fukuda M. Genomic organization of core 2 and I branching -1,6-N-acetylglucosaminyltransferase gene family. Glycobiology. 1995;5:417-425[Abstract/Free Full Text]. 34. Leppänen A, Salminen H, Zhu Y, et al. In vitro biosynthesis of a decasaccharide prototype of multiply branched polylactosaminoglycan backbones. Biochemistry. 1997;36:7026-7036[CrossRef][Medline] [Order article via Infotrieve]. 35. Leppänen A, Zhu Y, Maaheimo H, Helin J, Lehtonen E, Renkonen O. Biosynthesis of branched polylactosaminoglycans. J Biol Chem. 1998;273:17399-17405[Abstract/Free Full Text]. 36. Mattila P, Salminen H, Hirvas L, et al. The centrally acting 1,6N-acetylglucosaminyltransferase (GlcNAc to Gal). J Biol Chem. 1998;273:27633-27639[Abstract/Free Full Text]. 37. Dzierzkowa-Borodej W, Seyfried H, Nichols M, Reid M, Marsh WL. The recognition of water-soluble I blood group substance. Vox Sang. 1970;18:222-234[Medline] [Order article via Infotrieve]. 38. Marsh WL, Jensen L, Decary F, Colledge K. Water-soluble I blood group substance in the secretions of i adults. Transfusion. 1972;12:222-226[Medline] [Order article via Infotrieve]. 39. Watkins WM. Molecular basis of antigenic specificity: the ABO, H and Lewis blood group system. In: Montreuil J,Schachter H,Vliegenthart JFG, eds. Glycoproteins. Amsterdam: Elsevier Science; 1995:313-390. © 2001 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?