| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From the Infectious Disease and Immunology Division,
Queensland Institute of Medical Research and Joint Oncology Program,
University of Queensland, Herston, Australia.
Primary infection with the human herpesvirus, Epstein-Barr virus
(EBV), may result in subclinical seroconversion or may appear as
infectious mononucleosis (IM), a lymphoproliferative disease of
variable severity. Why primary infection manifests differently between
patients is unknown, and, given the difficulties in identifying donors
undergoing silent seroconversion, little information has been
reported. However, a longstanding assumption has been held that
IM represents an exaggerated form of the virologic and immunologic events of asymptomatic infection. T-cell receptor (TCR)
repertoires of a unique cohort of subclinically infected patients
undergoing silent infection were studied, and the results highlight a
fundamental difference between the 2 forms of infection. In contrast to
the massive T-cell expansions mobilized during the acute symptomatic phase of IM, asymptomatic donors largely maintain homeostatic T-cell
control and peripheral blood repertoire diversity. This disparity
cannot simply be linked to severity or spread of the infection because
high levels of EBV DNA were found in the blood from both types of acute
infection. The results suggest that large expansions of T cells within
the blood during IM may not always be associated with the control of
primary EBV infection and that they may represent an overreaction that
exacerbates disease.
(Blood. 2001;98:3739-3744) Epstein-Barr virus (EBV) is a Precisely what factors (eg, preimmune precursor CTLs, burst size,
affinity maturation, viral load) govern the extent of CTL expansion
development, not only in IM but in other acute viral infections,
remains largely unresolved. Infectious dose and degree of viral spread
(systemic vs localized infection) appear to be important. Size or
clonal burst of the antigen-specific CD8+ T-cell expansions
in acute LCMV infection are determined by antigen load
alone,13 whereas productive influenza A infection, which is largely restricted to the lung, elicits lower numbers of
CTLs.14 In EBV, viral load may be important The variable clinical manifestations of acute EBV infection
(asymptomatic vs mild to severe IM) offer an ideal opportunity to
assess various virologic and immunologic parameters and their relation
to the course of infection. Such comparative studies have been
virtually unachievable, however, given the difficulty in finding donors
without clinical symptoms at the time of EBV seroconversion. In the
current study, a panel of patients undergoing silent seroconversion was
serendipitously identified during screening for a phase 1 EBV vaccine
trial. Using this unique cohort, we show that in contrast to the
massive T-cell expansions elicited during the disease stage of acute
IM, asymptomatic donors showed little evidence of blood repertoire
perturbations. Furthermore, viral load studies revealed that this
occurred despite high levels of circulating EBV at the time of seroconversion.
Donors
T-cell receptor V The technique of CDR3 length determination and distribution to analyze
TCR repertoire diversity is based on the methodology described
previously.20 TCR V Statistical analysis CDR3 expansion was only considered significant if it satisfied the following criteria at least a 2-fold magnitude change from the acute to the persistent infection phase and probability indicating statistical significance (P < .05) against a control
background. The control background was calculated from data generated
from the HC donors.
T-cell receptor V-D-J junctional region sequencing Qiaex-purified TCR V PCR products were ligated into the
pGEM-T Vector System (Promega, Madison, WI) and were used to transform Epicurian Coli Sure Competent Cells (Stratagene, La Jolla, CA) according to the respective manufacturers' instructions. Plasmid inserts were amplified by PCR and were sequenced in both directions using the respective V primers and C with a Prism
Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit and an ABI377 DNA sequencer (Applied Biosystems). Monoclonal expansions were also
identified by direct sequencing of TCR V PCR products, which showed
that only a single nucleotide sequence was amplified.
Semiquantitative determination of EBV DNA load by polymerase chain reaction-enzyme-linked immunosorbent assay EBV DNA load was determined by amplification of a 304-bp segment of the BMLF1 region of the EBV genome using 5' and 3' primers, GTCAACCAACAAGGACACAT and CACCACCTTGTTTTGACGGG, respectively.22 The oligonucleotide probe, CCGCGGGAGCTAGGGGCAGG, specific for an internal region of the 304-bp product,22 was biotinylated at the 5' end during synthesis. Amplification of the BMLF1 region was carried out in a 25-µL reaction consisting of Ampgold buffer (Perkin-Elmer Cetus), 2 mM MgCl2, 0.5 µM each primer, and 200 µM dATP, dCTP, dGTP, 5.7 µM dUTP, 0.3 µM digoxigenin-dUTP (Boehringer-Mannheim, Castle Hill, Australia), 2.5 U Amplitaq Gold (Perkin-Elmer Cetus), and 100 ng genomic DNA as template. Genomic DNA was extracted (Qiagen Blood Kit; Qiagen, Clifton Hill, Australia) from donor PBMCs and from the EBV-positive cell line, Raji, which harbors 50 copies of EBV per cell. Raji DNA was added to 100 ng EBV seronegative PBMC DNA such that EBV copy numbers ranged from 1000 copies to 7.8 copies in doubling dilutions. These standards were used in the same PCR and acted as reference standards to determine EBV DNA load, which then was quantitatively assessed by using a PCR-enzyme-linked immunosorbent assay kit (DIG-detection; Boehringer-Mannheim) according to the manufacturer's instructions. All samples were made in a masked fashion, and in duplicate and negative controls they included water and PBMCs from an EBV-seronegative donor (EBV PBMC) and from
the EBV B-cell line BJAB .
Presence of blood lymphocytosis in infectious mononucleosis but not AS donors Primary infection with EBV can occur either asymptomatically, when only serologic evidence confirms infection, or symptomatically, when serology and clinical symptoms consistent with IM confirm diagnosis. The current study compares several features of the asymptomatic and symptomatic states. Four IM and 4 AS donors were included in the analysis. Peripheral blood samples from patients with IM were taken within 3 to 7 days of the onset of clinical symptoms (day 0). Consistent with early acute infection, a serologic pattern of primary infection (IgM+ VCA and IgG EBNA) was
detectable in IM and AS donors at the time of initial sampling (day 0)
(Table 1). For IM donors, the transition from primary to persistent
infection was accompanied by resolution of disease, and for IM and AS
donors it was accompanied by the disappearance of anti-VCA IgM
antibodies and the emergence of either an EBNA-specific or a
VCA-specific IgG response (Table 1). Total blood lymphocyte counts
differed significantly between IM and AS donors during the
seroconversion period. IM donors displayed striking lymphocytosis and
elevated levels of CD8+ lymphocytes at day 0 that were
observed to resolve to normal total lymphocyte levels
( 2 × 106/mL) on disease recovery (Table 1). In
contrast, primary infection in the 4 AS seroconvertants occurred in the
absence of significant lymphocytosis, with PBMC levels and
CD8+ lymphocyte counts falling within the normal range
(Table 1). Donor AS2 did show unusually low levels of circulating
CD4+ lymphocytes (Table 1), but this was not associated
with EBV seroconversion because the decrease was consistently observed on serial measurements taken before day 0 sampling, when the donor was
EBV seronegative (data not shown).
Major T-cell receptor expansions are common in infectious mononucleosis To determine the global impact of EBV infection on PBMC repertoire diversity, PBMCs from 3 donors undergoing acute symptomatic infection were subjected to TCR analysis by immunoscope. This is a PCR-based technique that determines the distribution of CDR3 lengths within a given TCR V family. Gaussian-shaped profiles represent a diverse array of clonotypes of varying CDR3 lengths, whereas oligoclonal peak profiles have been shown to represent clonally
expanded T cells (reviewed in Pannetier et al23). Because the uniquely rearranged CDR3 region directly contacts the peptide antigen,24,25 this technique provides a sensitive
indicator of antigen-specific clonal expansion. CDR3 profiles were
compared between primary infection and after disease recovery to
confirm whether they represented EBV-induced changes or formed part of the normal TCR repertoire for the patient. Because the V repertoire of CD8+ cells26 and CD8+
CD45RO+ memory cells27 in healthy adults is
often skewed, presumably as a result of previous antigen challenge (eg,
after EBV infection),28 repertoire perturbations were
monitored at the PBMC level, which rarely showed any deviation from a
polyclonal, Gaussian-shaped profile. As shown in Figure
1, dramatic distortions in repertoire distribution were evident for at least 50% of the TCR V families for each of the IM donors. These perturbations represented at least a
2-fold magnitude change and were statistically significant (P < .05) against a normal control background. For donor
IM3, in whom a follow-up bleed was unavailable, expansions were
confirmed based on statistical significance to normal control
background levels. Overall, as expected for an HLA-unmatched cohort of
IM donors, each donor exhibited a largely unique pattern of V
expansions of a particular CDR3 length that were found to resolve to
normal Gaussian-like TCR profiles after disease recovery.
A single expanded peak in any given V
Major T-cell receptor expansions are uncommon in asymptomatic infection To investigate whether TCR repertoire perturbations eventuate in the absence of a detectable lymphocytosis, the PBMC repertoires of the 4 donors undergoing asymptomatic primary infection were assessed by immunoscope. In stark contrast to the dramatic and selective expansions observed in IM, most asymptomatic donors showed Gaussian-like profiles that remained unperturbed from the primary to the persistent stage of infection (Figure 3). Occasionally, minor repertoire perturbations were observed, but, despite lowering the cut-off criteria from a 2-fold to a 1.75-fold change in magnitude, these were not found to be statistically significant. The exception was donor AS4, who exhibited 6 V families that proved to
be significantly skewed (P < .05). The TCR V-D-J
junctional sequencing showed that several of these represented clonal
expansions (Figure 4).
High levels of EBV genomes circulate in asymptomatic primary infection An important virologic parameter that may regulate the clinical outcome and the expansion or mobilization of T cells during primary EBV infection is viral load. To investigate whether the absence of major T-cell expansions during subclinical primary infection was associated with a low-level underlying viral infection, EBV genome copy number per microgram total cellular DNA was determined in PBMCs by semiquantitative PCR-ELISA. Three asymptomatic seroconvertants (AS1, AS3, AS4), 3 IM donors (IM1, IM3, IM4), and 3 seropositive healthy control donors (HC1, HC2, HC3) were assessed (Figure 5). Consistent with previous reports, viral genomes were low or undetectable in healthy control donors, reflective of low-level latent infection,6,29 whereas the level of circulating EBV DNA was 500- to 1000-fold increased in those with IM. Surprisingly, very high viral loads were also detected in 2 (AS1, AS4) donors undergoing asymptomatic primary EBV infection, and the third (AS3), though not as intense, showed levels well above (greater than 70-fold) those of background healthy controls. These unexpectedly high levels of EBV DNA fell to undetectable levels on establishment of persistent latent infection. Overall, the data provide compelling evidence of high systemic EBV DNA levels in silent primary infection despite the lack of detectable peripheral T-cell expansions.
This report highlights new findings regarding the biology of
primary EBV infection. First, in contrast to acute IM, subclinical infection does not evoke a massive peripheral T-cell response, as
evidenced by the lack of significant blood lymphocytosis and selective expansions of V The impressive mobilization of activated CD8+ T cells in
response to acute EBV infection is well documented in IM. Consistent with the results of this study, selective expansions of dominant V An important correlate with disease development in IM appears to be the development of a significant blood CD8+ T-cell lymphocytosis. Indeed, patients who undergo silent seroconversion have normal levels of blood mononuclear cells, whereas elevated levels are characteristic of symptomatic seroconversion. A similar observation is reported in children who asymptomatically contract EBV for the first time; transient lymphocytosis is noted in only a small number, and most demonstrate no hematologic disturbances.2 Although more quantitative studies are needed that measure the degree and duration of lymphocytosis with the severity of clinical symptoms, it appears that the severity of immunopathology in IM is modulated by participating T-cell numbers. In support, the disease course of IM closely parallels the lymphoproliferative phase in which activated T cells appear in the blood.41 Furthermore, our recent discovery that EBV-specific T cells cross-react with self-antigens strengthens the possibility that such cross-reactions in abundance could lead to lysis of uninfected host cells, thereby contributing to disease exacerbation.19 Also of likely importance are the as yet unidentified homeostatic regulatory mechanisms that bring the T-cell response under control. Interestingly, the presence of T-cell perturbations is not necessarily linked to increased numbers of T cells within the circulation. For example, dominant TCR expansion profiles are documented in PBMCs of HIV-infected patients without elevated levels of CD8+ cells.37 In the current study, major T-cell expansions were evident despite the absence of blood lymphocytosis in one of the asymptomatic donors studied (donor AS4; Figure 3). Therefore, homeostatic T-cell control may be maintained in some instances during active stimulation of an antiviral T-cell response. Clearly, our studies suggest that the magnitude of the CD8+ response to EBV is likely to be considerably lower in the asymptomatic form of primary EBV infection. Yet these donors responded to high levels of systemic virus infection without having clinical symptoms. Strong EBV-specific memory CTL responses to commonly targeted epitopes within several viral latent gene products have been detected in infants who previously had asymptomatic EBV infection.42 It remains to be seen whether the primary asymptomatic T-cell response is qualitatively different (eg, in breadth or specificity of CTL reactivity) than that in IM. What then triggers the development of T-cell lymphocytosis and disease during primary EBV infection? It is highly likely that interdependent host and virologic factors are involved in the regulation of disease development. Polymorphisms of the interleukin-1 (IL-1) gene complex43 and of the IL-10 gene44 have been linked to susceptibility to EBV infection and, in the case of IL-10, to lymphoproliferative disease severity. Similarly, disease severity after respiratory syncytial virus infection appears to be associated with the IL-8 gene region,45 and elevated serum levels of Fas ligand are associated with the asymptomatic stage of HIV infection.46 An important virologic parameter controlling the level of T-cell expansion development may be the type of life cycle adopted by the virus in vivo. EBV can establish latent or lytic infection, and the virus has evolved several gene regulatory mechanisms (eg, transcriptional, posttranscriptional, and posttranslational) for controlling its own gene expression (reviewed in Kieff47). Therefore, the tantalizing possibility exists that EBV establishes a different form of infection or pattern of gene expression in IM than it does during asymptomatic seroconversion. For instance, the high viral load observed in silent primary infection might result from an increase in the number of latently infected B cells in the blood, whereas in IM there may be more virus replication. Significantly, notable features of IM are the presence of lytically infected B cells within the blood,48 high titers of antibodies against lytic cycle proteins,16 and high amounts of free virus DNA in the serum.49,50 Furthermore, studies monitoring CTL responses during acute IM have established that a sizable proportion of the total CD8+ response is directed toward lytic rather than latent antigen recognition.12,32 Additional support for lytic infection, possibly contributing to disease etiology in IM, is the isolation of an EBV strain with an increased propensity for lytic rather than latent B cell infection from a patient with severe chronic active infection.51 In conclusion, we have shown that the expansion of T cells in response
to acute EBV infection differs depending on whether the infection
progresses without clinical symptoms or develops into IM. Furthermore,
the development of large peripheral T-cell expansions during IM
We thank Andrew Rosenstengel and Stephanie Pye for their valuable technical assistance with the EBV phase 1 vaccine trial.
Submitted February 27, 2001; accepted July 31, 2001.
Supported by grants from the National Health and Medical Research Council of Australia.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sharon L. Silins, Queensland Institute of Medical Research, PO Box Royal Brisbane Hospital, Australia 4029; e-mail: sharons{at}qimr.edu.au.
1. Khanna R, Burrows SR. Role of cytotoxic T lymphocytes in Epstein-Barr virus-associated diseases. Annu Rev Microbiol. 2000;54:19-48[CrossRef][Medline] [Order article via Infotrieve]. 2. Biggar RJ, Henle W, Fleisher G, Bocker J, Lennette ET, Henle G. Primary Epstein-Barr virus infections in African infants, II: clinical and serological observations during seroconversion. Int J Cancer. 1978;22:244-250[Medline] [Order article via Infotrieve]. 3. Fleisher G, Henle W, Henle G, Lennette ET, Biggar RJ. Primary infection with Epstein-Barr virus in infants in the United States: clinical and serologic observations. J Infect Dis. 1979;139:553-558[Medline] [Order article via Infotrieve]. 4. Klein G, Svedmyr E, Jondal M, Persson PO. EBV-determined nuclear antigen (EBNA)-positive cells in the peripheral blood of infectious mononucleosis patients. Int J Cancer. 1976;17:21-26[Medline] [Order article via Infotrieve]. 5. Katsuki T, Hinuma Y, Saito T, et al. Simultaneous presence of EBNA-positive and colony-forming cells in peripheral blood of patients with infectious mononucleosis. Int J Cancer. 1979;23:746-750[Medline] [Order article via Infotrieve].
6.
Kimura H, Morita M, Yabuta Y, et al.
Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay.
J Clin Microbiol.
1999;37:132-136
7.
Chen ZW, Kou ZC, Lekutis C, et al.
T cell receptor V beta repertoire in an acute infection of rhesus monkeys with simian immunodeficiency viruses and a chimeric simian-human immunodeficiency virus.
J Exp Med.
1995;182:21-31
8.
Wilson JD, Ogg GS, Allen RL, et al.
Oligoclonal expansions of CD8(+) T cells in chronic HIV infection are antigen specific.
J Exp Med.
1998;188:785-790
9.
Sourdive DJ, Murali-Krishna K, Altman JD, et al.
Conserved T cell receptor repertoire in primary and memory CD8 T cell responses to an acute viral infection.
J Exp Med.
1998;188:71-82 10. Pantaleo G, Demarest JF, Soudeyns H, et al. Major expansion of CD8+ T-cells with a predominant V beta usage during the primary immune response to HIV. Nature. 1994;370:463-467[CrossRef][Medline] [Order article via Infotrieve]. 11. Tomkinson BE, Wagner DK, Nelson DL, Sullivan JL. Activated lymphocytes during acute Epstein-Barr virus infection. J Immunol. 1987;139:3802-3807[Abstract].
12.
Callan MFC, Tan L, Annels N, et al.
Direct visualization of antigen-specific CD8+ T cells during the primary immune response to Epstein-Barr virus in vivo.
J Exp Med.
1998;187:1395-1402
13.
Gallimore A, Glithero A, Godkin A, et al.
Induction and exhaustion of lymphocytic choriomeningitis virus-specific cytotoxic T lymphocytes visualized using soluble tetrameric major histocompatibility complex class I-peptide complexes.
J Exp Med.
1998;187:1383-1393 14. Flynn KJ, Belz GT, Altman JD, Ahmed R, Woodland DL, Doherty PC. Virus-specific CD8+ T cells in primary and secondary influenza pneumonia. Immunity. 1998;8:683-691[CrossRef][Medline] [Order article via Infotrieve].
15.
Riddler SA, Breinig MC, McKnight JL.
Increased levels of circulating Epstein-Barr virus (EBV)infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of posttransplant lymphoproliferative disease in solid-organ transplant recipients.
Blood.
1994;84:972-984 16. Rickinson AB, Kieff E. Epstein-Barr virus. In: Fields BN,Knipe DM,Howley PM, eds. Fields Virology. Philadelphia, PA: Lippincott-Raven; 1996:2397-2446.
17.
Argaet VP, Schmidt CW, Burrows SR, et al.
Dominant selection of an invariant T-cell antigen receptor in response to persistent infection by Epstein-Barr virus.
J Exp Med.
1994;180:2335-2340
18.
Silins SL, Cross SM, Elliott SL, et al.
Selection of a diverse TCR repertoire in response to an Epstein-Barr virus-encoded transactivator protein BZLF1 by CD8+ cytotoxic T lymphocytes during primary and persistent infection.
Int Immunol.
1997;9:1745-1755 19. Misko IS, Cross SM, Khanna R, et al. Cross-reactive recognition of viral, self and bacterial peptide ligands by human class I-restricted cytotoxic T lymphocyte clonotypes: implications for molecular mimicry in autoimmune diseases. Proc Natl Acad Sci U S A. 1999;6:2279-2284.
20.
Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P.
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line.
Proc Natl Acad Sci U S A.
1993;90:4319-4323 21. Chothia C, Boswell DR, Lesk AM. The outline structure of the T-cell alpha beta receptor. EMBO J. 1988;7:3745-3755[Medline] [Order article via Infotrieve]. 22. Pedneault L, Katz BZ. Comparison of polymerase chain reaction and standard Southern blotting for the detection of Epstein-Barr virus DNA in various biopsy specimens. J Med Virol. 1993;39:33-43[Medline] [Order article via Infotrieve]. 23. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;16:176-181[CrossRef][Medline] [Order article via Infotrieve].
24.
Garcia KC, Degano M, Stanfield R, et al.
An alpha-beta T cell receptor structure at 2.5 angstrom and its orientation in the TCR-MHC complex.
Science.
1996;274:209-219 25. Garboczi DN, Ghosh P, Utz U, Fan QR, Biddison WE, Wiley DC. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature. 1996;384:134-141[CrossRef][Medline] [Order article via Infotrieve].
26.
Posnett DN, Sinha R, Kabak S, Russo C.
Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy."
J Exp Med.
1994;179:609-618 27. Bonfert V, Cihak J, Losch U, Ziegler-Heitbrock HWL. Preferential expression of V beta gene families in CD8 memory cells of apparently healthy donors. Cell Immunol. 1995;166:165-171[CrossRef][Medline] [Order article via Infotrieve]. 28. Silins SL, Cross SM, Krauer KG, Moss DJ, Schmidt CW, Misko IS. A functional link for major TCR expansions in healthy adults caused by persistent Epstein-Barr virus infection. J Clin Invest. 1998;102:1551-1558[Medline] [Order article via Infotrieve]. 29. Babcock GJ, Decker LL, Freeman RB, Thorley-Lawson DA. Epstein-Barr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients. J Exp Med. 1999;90:567-576. 30. Callan MFC, Steven N, Krausa P, et al. Large clonal expansions of CD8+ T cells in acute infectious mononucleosis. Nat Med. 1996;2:906-911[CrossRef][Medline] [Order article via Infotrieve].
31.
Silins SL, Cross SM, Elliott SL, et al.
Development of Epstein-Barr virus-specific memory T-cell receptor clonotypes in acute infectious mononucleosis.
J Exp Med.
1996;184:1815-1824
32.
Steven NM, Annels NE, Kumar A, Leese AM, Kurilla MG, Rickinson AB.
Immediate early and early lytic cycle proteins are frequent targets of the Epstein-Barr virus-induced cytotoxic T cell response.
J Exp Med.
1997;185:1605-1617
33.
Khanna R, Sherritt M, Burrows SR.
EBV structural antigens, gp350 and gp85, as targets for ex vivo virus-specific CTL during acute infectious mononucleosis: potential use of gp350/gp85 CTL epitopes for vaccine design.
J Immunol.
1999;162:3063-3069
34.
Hoshino Y, Morishima T, Kimura H, Nishikawa K, Tsurumi T, Kuzushima K.
Antigen-driven expansion and contraction of CD8+-activated T cells in primary EBV infection.
J Immunol.
1999;163:5735-5740
35.
Pantaleo G, Demarest JF, Schacker T, et al.
The qualitative nature of the primary immune response to HIV infection is a prognosticator of disease progression independent of the initial level of plasma viremia.
Proc Natl Acad Sci U S A.
1997;94:254-258 36. Gorochov G, Neumann AU, Kereveur A, et al. Perturbation of CD4+ and CD8+ T-cell repertoires during progression to AIDS and regulation of the CD4+ repertoire during antiviral therapy. Nat Med. 1998;4:215-221[CrossRef][Medline] [Order article via Infotrieve].
37.
Than S, Kharbanda M, Chitnis V, Bakshi S, Gregersen PK, Pahwa S.
Clonal dominance patterns of CD8 T cells in relation to disease progression in HIV-infected children.
J Immunol.
1999;162:3680-3686
38.
Ogg GS, Jin X, Bonhoeffer S, et al.
Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA.
Science.
1998;279:2103-2106 39. Mellors JW, Rinaldo CRJ, Gupta P, White RM, Todd JA, Kingsley LA. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science. 1996;272:1167-1170[Abstract] 40. Iuliano R, Forastieri G, Brizzi M, Mecocci L, Mazzotta F, Ceccherini-Nelli L. Correlation between plasma HIV-1 RNA levels and the rate of immunologic decline. J Acquir Immune Defic Syndr Hum Retrovirol. 1997;14:408-414[Medline] [Order article via Infotrieve]. 41. Svedmyr E, Ernberg I, Seeley J, Weiland O, Masucci G, Tsukuda K. Virologic, immunologic, and clinical observations on a patient during the incubation, acute, and convalescent phases of infectious mononucleosis. Clin Immunol Immunopathol. 1984;30:437-450[CrossRef][Medline] [Order article via Infotrieve]. 42. Tamaki H, Beaulieu BL, Somasundaran M, Sullivan JL. Major histocompatibility complex class I-restricted cytotoxic T lymphocyte responses to Epstein-Barr virus in children. J Infect Dis. 1995;172:739-746[Medline] [Order article via Infotrieve]. 43. Hurme M, Helminen M. Polymorphism of the IL-1 gene complex in Epstein-Barr virus seronegative and seropositive adult blood donors. Scand J Immunol. 1998;48:219-222[CrossRef][Medline] [Order article via Infotrieve]. 44. Helminen M, Lahdenpohja N, Hurme M. Polymorphism of the interleukin-10 gene is associated with susceptibility to Epstein-Barr virus infection. J Infect Dis. 1999;180:496-499[CrossRef][Medline] [Order article via Infotrieve]. 45. Hull J, Thomson A, Kwiatkowski D. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax. 2000;55:1023-1027< |