|
|
 Previous Article | Table of Contents | Next Article 
Blood, Vol. 96 No. 2 (July 15), 2000:
pp. 420-428
CHEMOKINES
The C-class chemokine, lymphotactin, impairs the induction of
Th1-type lymphokines in human CD4+ T cells
Chantal Cerdan,
Edgar Serfling, and
Daniel Olive
From the National Institute of Health and Medical Research,
University of Méditerranée, Marseille, France; Department
of Molecular Pathology, Institute of Pathology, Würzburg,
Germany.
 |
Abstract |
Chemokines are involved in the regulation of leukocyte migration and
for some of them, T-cell costimulation. To date, the only direct
property of lymphotactin (Lptn), the unique member of the C class of
chemokines, consists of T-cell chemoattraction. This report describes a
novel function for Lptn in human T-lymphocyte biology, by demonstrating
the direct ability of Lptn to both inhibit and costimulate
CD4+ and CD8+ T-cell activation,
respectively. Lptn but not RANTES inhibited CD4+ T-cell
proliferation, through a decreased production of Th1 (interleukin [IL]-2, interferon [IFN]- ) but not Th2 (IL-4, IL-13)
lymphokines, and decreased IL-2R expression. Transfections in Jurkat
cells showed a Lptn-mediated transcriptional down-regulation of
gene-promoter activities specific for Th1-type lymphokines, as well as
of nuclear factor of activated T cells (NF-AT) but not AP-1 or
NF-KB enhancer activities. This suppressive action of
Lptn could be compensated by overexpression of NF-ATc but not NF-ATp.
CD4+ T-cell proliferation was completely restored by
exogenous IL-2 or reversed by pertussis toxin, wortmannin, and
genistein, suggesting the involvement of multiple partners in Lptn
signaling. In contrast to CD4+ cells, Lptn exerted a
potent costimulatory activity on CD8+ T-cell
proliferation and IL-2 secretion. These data provide important insights
into the role of Lptn in differential regulation of normal human T-cell
activation and its possible implication in immune response disorders.
(Blood. 2000;96:420-428)
© 2000 by The American Society of Hematology.
| |
Introduction |
Chemokines play an important role in the recruitment and activation of
specific subsets of leukocytes.1 With the exception of
lymphotactin (Lptn), all chemokines share a conserved 4-cysteine motif
in their N-terminus. They can be divided into 4 subfamilies designated
as CXC ( -chemokine), CC ( -chemokine), CX3C
( -chemokine), or C (-chemokine), based on structural, genetic,
and functional criteria. Although the number of both CXC and CC members
is continually growing, the C and CX3C groups contain only
single representatives, named Lptn/SCM-1/ATAC2-4 and
fractalkine/neurotactin,5,6 respectively. CXC chemokines
mainly target neutrophils and T cells, whereas CC chemokines generally
attract monocytes, eosinophils, basophils, and T cells, with variable
selectivity. In contrast, both C and CX3C chemokines have a
more restricted specificity for T cells. For instance, both in vitro
and in vivo, Lptn is efficiently chemotactic toward both
CD8+ and CD4+ T cells, but only modestly toward
natural killer (NK) cells.2,7-10 CC chemokines play an
increasingly important role in lymphocyte functions, promoting
proliferation, cytotoxicity, Ig production, adhesion, and protection
against apoptosis.11-16 Despite the fact that the receptor
for Lptn, XCR1,17 like most chemokine
receptors1 belongs to the 7-TM G-protein-coupled receptor
(GPCR) superfamily, and that the range of cells producing and
responding to Lptn has been broadened to include activated
CD8+ and CD4+ T cells,2-4,18 NK
cells,9 and mast cells,19 the original direct
activity ascribed to Lptn, chemotaxis, remains to date its only known function.
In physiologic situations, commitment to optimal T-cell activation
requires both CD3/TcR complex engagement through peptide-major histocompatibility complex combinations, in conjunction with a costimulatory signal such as that provided by interaction between CD28
and its ligands, B7.1/CD80 and B7.2/CD86. The CD28 costimulatory signal
synergizes with the CD3/TcR mitogenic signal to promote cell cycle
progression, cytokine receptor expression (interleukin [IL]-2R)20,21, and production of
cytokines,22,23 as, for instance, some CC
chemokines.24 A new emerging negative role for CD28 has,
however, been evidenced by several studies showing that this pathway
also reduced gene expression such as that of FasL,25 some
CC chemokine receptors,26-30 as well as 1 chemokine, Lptn, in human peripheral CD4+ but not CD8+ T
cells.31
We describe here that Lptn may act as a negative regulator of human
CD4+ T-cell activation. Effectively, Lptn, but not CC
chemokines, such as RANTES or macrophage inflammatory protein
(MIP)-1, inhibits CD4+ T-cell proliferation induced by
mitogenic signal from CD3/TcR, by inhibiting the production of Th1
(IL-2, interferon [IFN]-) but not Th2 (IL-4, IL-13) cytokines,
mainly that of IL-2 and consequently the IL-2R surface expression.
Using luciferase transfection assays in Jurkat cells, we demonstrate a
reduced transcriptional activity of gene promoter activities specific
for Th1-type lymphokines such as IL-2 and IFN-, following CD3
stimulation in the presence of Lptn. The Lptn-mediated Th1-promoter
repression correlates with reduced transcription driven by NF-AT but
not NF-KB or AP-1. It was restored by NF-ATc but not NF-ATp
expression, indicating NF-ATc as a potential molecular target for Lptn.
We also show that the Lptn-mediated inhibition of CD4+
T-cell proliferation is reversed by pertussis toxin (PT), confirming signaling through Gi proteins, in line with the
molecular nature of Lptn receptor, but also by wortmannin and
genistein. Furthermore, such blockade of proliferation is likely to be
caused by a lack of IL-2/IL-2R signal transmission, as demonstrated by
its complete reversal by exogenous IL-2. Lastly, we emphasize a
differential role of Lptn in CD4+ and CD8+
T-cell activation, showing that Lptn positively regulates
CD8+ T-cell proliferation, at least by increasing IL-2
production. From these observations, we conclude that Lptn represents,
at least in vitro, a direct regulator of human T-cell activation either
negatively or positively depending on the CD4+ or
CD8+ subset, opening thus a new potential field for Lptn
activity in the regulation of Th1 lymphokine production.
| |
Materials and methods |
CD4+ and CD8+ T-cell purification and
activation
Total T cells were isolated from mononuclear cells as described
elsewhere20 and were purified in CD4+ and
CD8+ cells, as recommended by the manufacturer, using
antimouse IgG magnetic immunobeads (Immunotech, Marseille, France),
that were coupled with CD8 (10B4.6) or CD4 (13B8.2) (D. Olive) monoclonal antibodies (mAbs), respectively. Both
subsets were more than 90% pure before activation and remained at this
degree of purity over the entire period of stimulation (7 days), as
controlled by labeling with specific mAbs. These cells
(1 × 106/mL) were activated with coated CD3 (289)
mAb, singly or in combination with recombinant human Lptn (PromoCell
GmbH, Heidelberg, Germany) that was used either in a soluble form (when
stated) or coated (when not stated) on plates at the same time as CD3
mAb. Usually, the optimal concentration of Lptn used was 1 µg/mL,
unless otherwise stated. In each experiment, the specificity of
Lptn-mediated effects was controlled by using the recombinant human
chemokines, RANTES or MIP-1 (R&D Systems Europe Ltd, Abingdon, UK
for both, PromoCell GmbH for RANTES), in the same conditions as for
Lptn (1µg/mL unless otherwise indicated, coated at the same time as
CD3 mAb). In certain proliferation assays, coated CD3 mAb, a
combination of PMA (10-9 mol/L, Sigma, St
Quentin-Fallavier, France) and ionomycin (2.5 µg/mL,
Sigma), a CD2 pair of mAbs20 were used each in combination with CD28 mAb to activate the cells. In the indicated experiments, the
following reagents were added to the cells just before activation: recombinant human IL-2 (Chiron, France) at 300 U/mL, soluble Abs, all
used at 25 µg/mL, directed against IL-2R chain (33B3.1, blocking the high affinity IL-2 binding site or 36A1.2,
nonblocking),20 IL-2 (clone IL-2-66, Immunotech), Lptn
(PromoCell GmbH), RANTES or MIP-1 (R&D Systems Europe Ltd for both;
PromoCell GmbH for RANTES). In some experiments, cells were
either left untreated or pretreated at 37°C for 15 minutes
before activation for 2 days, with the following signal transduction
inhibitors: PT (GPCR), genistein (PTK), wortmannin (PI3K), PD98059
(anti-MEK), and FHP1 (anti-p38).
Proliferation assays
The T cells were plated at 1 × 106/well in
flat-bottom 24-well plates (Costar Corporation, Cambridge, MA),
previously coated with CD3 mAb, alone or in conjunction with Lptn or
the control chemokines. After 96 hours, wells were pulsed with 1µCi
of [3H]-thymidine (Amersham France, Les Ulis, France) for
the remaining 18 hours and then harvested onto glass fiber filters.
Thymidine incorporation was measured in a direct beta counter (Matrix
9600, Packard Instruments, Paris, France). In parallel
with thymidine incorporation, T-cell viability was assessed by trypan
blue exclusion counting, at various days after activation.
Lymphokine secretion assays
Supernatants were collected from cultures of CD4+ or
CD8+ T cells at various times after activation and frozen
at  80°C until analysis. Quantitative determination of
lymphokine production was assessed by enzyme-linked immunosorbent
assays (ELISA), using commercial kits from Immunotech, for IL-2 and
IL-4, and from both Immunotech and TEBU for IFN- (Pelikine compact
human IFN-, CLB, Amsterdam, The Netherlands). Serial dilutions of
the supernatants were performed to ensure measuring in the linear
range, and the sensitivity of each ELISA assay was 5 pg/mL. Preliminary
assays determined that day 3 lymphokine levels were most consistent for IFN- and IL-4, whereas for IL-2 the peak of production occurred at
day 1. Therefore, extensive analyses were performed at these time points.
Analysis of cell surface antigen expression
Fluorescence activated cell sorter (FACS) analysis was undertaken
using standard protocols. Briefly, T cells were resuspended at
2 × 105/well in 96-well V-bottom plates (Costar)
and incubated for 45 minutes at 4°C, with fluorescein
isothiocyanate (FITC)- or phycoerythrin (PE)-coupled mAbs directed
against the following markers: CD3, IL-2R, IL-2R, CD4, CD8, CD2,
CD50, CD54, CD11a, CD11b, CD11c, CD28, CTLA-4, CD80, CD86, CD40, CD40L,
CD45RO, CD45RA, CD95, and CD19 as a negative control. After staining,
cells were washed, fixed with 0.02% paraformaldehyde, and analyzed
with a Becton Dickinson (Mountain View, CA) FACScan flow cytometer.
Acquisitions were based on the forward and side-scatter characteristics
and 10 000 events were acquired.
Transient transfections of Jurkat cells and luciferase assays
The human Jurkat T leukemia subclone JA1632 was
maintained in RPMI 1640 medium supplemented with 10% fetal calf serum
(FCS), penicillin, and streptomycin. Cells
(1 × 107) were electrotransfected using a BioRad
Gene Pulser (250 V, 960 µF) with 15 µg (unless otherwise stated) of
the following plasmids: pIL-2(541/+57)/FLuc (Fluc for
firefly luciferase), pIFN-(538/+64)/Fluc (respective
gifts of E. Verdin,33 N. Tanaka,34 L. Penix35), and pIL-4(269/+11)/FLuc (gift of M. Li-Weber 36). Cells were always cotransfected with 2.5 µg
of pactin-Rluc reporter gene composed of -actin promoter fused
with Renilla luciferase (Rluc) (gift of R. Castellano). In some
experiments, transfections were performed using pIL-2/Fluc, alone or in
conjunction with 2.5 µg of the complimentary DNA (cDNA) expression
vectors pRSV-NF-ATc/C or pRSV-NF-ATp.37 Following
transfection, cells were maintained for 2 hours in RPMI 10% FCS and
then left unstimulated or stimulated overnight, as described for
primary T cells. They were then washed and lysed. Proteins were
quantified by Bradford reagent (Bio-Rad). Ten micrograms of protein
cell lysate was subjected to dual-luciferase reporter assay (DLR cat.
N°E1910, Promega, Cherbonnières, France), according to the manufacturer's instruction. The efficiency of transfection was corrected by the activity of Fluc normalized to that
of Rluc. The enhancer assay plasmids p3 × NF-AT-FLuc, p5 × AP-1-Fluc, and p2 × NF-KB-Fluc linked with minimal promoter were previously referenced.38
Reverse transcription-polymerase chain reaction (RT-PCR)
The CD4+ T cells were activated for 24 or 48 hours as
described above, after which total RNA was prepared by the RNAzol
method (RNA-B, BIOPROBE Systems, Montreuil, France) according to the manufacturer's instructions. cDNA was prepared from 1 µg of RNA using an hexanucleotide random primer (Pharmacia Biotech) and II
reverse transcriptase (GIBCO BRL, LifeTechnologies) in a
total volume of 20 µL. A volume of 2.5 µL (1/8 of the total cDNA
product) was used for PCR amplification, simultaneously using 2 pairs
of primers specific for the lymphokine messenger RNA (mRNA) tested and
for the 2-microglobulin mRNA (Hu2m), that
was used as an internal and invariant control. Each PCR reaction was
conducted in a total volume of 25 µL containing 1 × PCR
buffer, dNTP (200 nmol/L final), MgCl2 (1.5 mmol/L final),
sense and antisense primers (100 ng/µL), and 2.5 U of Taq polymerase
(except for the primers, all the reagents were supplied by GIBCO BRL,
LifeTechnologies), according to the manufacturer's instructions. The
primers were as follows: either CCAGCAGAGAATGGAAAGTC and
TAAGTTGCCAGCCCTCCTAG or CCAGCAGAGAATGGAAAGTC and GATGCTGCTTACATGTCTCG
(sense and antisense for the Hu2m 460 bp or 268 bp
fragments, respectively); GTCACAAACAGTGCACCTAC and ATGGTTGCTGTCTCATCAGC
(sense and antisense for IL-2); GCAGAGCCAAATTGTCTCCT and
ATGCTCTTCGACCTCGAAAC (sense and antisense for IFN-); and TGCAATGGCAGCATGGTATG and GCAGGTCCTTTACAAACTGG (sense and antisense for
IL-13). Each sample was amplified for 30 cycles in a Perkin/Elmer 480 (94°C for 5 minutes for preheating, 94°C for 50 seconds to denature the DNA, 65°C for 45 seconds for annealing, and 72°C for 45 seconds for extension) resulting in 460-bp, 352-bp, 290-bp, and
214-bp products, for Hu2m, IL-2, IFN-, and IL-13,
respectively. The number of 30 amplification rounds was previously
determined to produce linear increases in target cDNAs. Electrophoresis
was performed on 25 µL of each sample loaded onto 2% agarose gel
stained with ethidium bromide. Integrated intensities of the specific bands were determined using a transilluminator 320 nm camera (Raytest, GmbH, Straubenhardt, Germany), and the results were normalized to the
intensity of the Hu2m and expressed in arbitrary units as the ratio of the 2 intensities.
| |
Results |
Lptn inhibits the proliferation of human peripheral
CD4+ T cells
Although CC chemokines such as RANTES or MIP-1 were described to
be positively involved in costimulation of human T-cell proliferation,
cytokine production, and expression of various adhesion and activation
receptors,11,13,14 the C chemokine, Lptn, has never been
observed to have any effect other than chemotaxis. Because we already
demonstrated that the production of Lptn was strongly induced by
CD3/TcR activation alone, but down-regulated by CD28 costimulation in
CD4+ but not in CD8+ T cells,31 we
sought to determine whether Lptn might directly interfere with T-cell
activation. For this purpose, we examined the effect of recombinant
Lptn on the proliferation of purified CD4+ T cells
activated via CD3/TcR alone. Surprisingly, when these cells were
subjected to this stimulus, in presence of coated (Figure 1A, C), or to a lesser extent, soluble Lptn
(Figure 1B), they displayed markedly decreased proliferation, compared
to the same cells activated in the absence of Lptn. A respective 2.5- and 2-fold reduction was observed with coated and soluble forms of Lptn, irrespective of whether the proliferation was measured by thymidine uptake (peak at day 5, Figure 1) or viable cell counting (not
shown). Equivalent concentrations of either soluble (not shown) or
coated RANTES (Figure 1A, C) or MIP-1 (not shown), as well as their
specific neutralizing antibodies (Figure 1A, C for anti-RANTES) did not
noticeably affect proliferation, indicating the selectivity of Lptn in
down-regulating CD4+ T-cell proliferation. Controlling the
same experiments, the addition of either exogenous IL-2 or a blocking
IL-2+IL-2R mAb combination caused a drastic increase or reduction of
thymidine uptake, respectively (not shown). A typical curve dose
response of Lptn showed a plateau effect of inhibition of thymidine
uptake at doses ranging from 500 ng/mL up to at least 10 µg/mL
(Figure 1C). The proliferation was not affected at all by
concentrations of RANTES varying from 100 ng/mL to 10 µg/mL (Figure
1C for 10 µg/mL, and not shown). Taken together, these results
indicated for the first time that Lptn could negatively interfere with
human CD4+ T-cell proliferation.
View larger version (35K):
[in this window]
[in a new window]
| Fig 1.
Inhibition of human CD4+ T cell
proliferation by Lptn.
(A) [3H]-TdR incorporation of 1 × 105
cells purified CD4+ T cells activated with plate-bound CD3
mAb for 5 days, in the presence or absence of the following reagents:
Lptn or RANTES coated at the same time as CD3 mAb, and their specific
antibodies. The [3H]-TdR pulse was undertaken as
described in "Materials and methods." Results are expressed as
the mean values of cpm from quadruplicate cultures, obtained from 7 independent experiments. The error bars were derived from standard
deviations of the determinations. The 33 × 103 cpm
were obtained in response to CD3 and CD28 costimulation (positive
control) as compared with 11.5 × 103 cpm for CD3
alone (not shown). (B) The [3H]-TdR incorporation was
measured from CD4+ T cells activated in the same conditions
as in panel A, except for the presence of soluble instead of coated
Lptn. The figure represents the mean values ± SD of 3 independent
experiments. (C) The CD4+ T cell [3H]-TdR
pulse induced by CD3 stimulation is reduced in a dose-dependent manner
by Lptn. Each point of the curve represents the mean ± SD of cpm
from 2 independent experiments performed in triplicate.
|
|
Lptn inhibits Th1 but spares Th2 lymphokine secretion by
CD4+ T cells
Because Lptn drastically inhibited the proliferation of
CD4+ T cells, we next evaluated its role in the production
of Th1 and Th2 lymphokines. Supernatants of CD4+ T cells
activated via CD3, in presence or absence of Lptn, were harvested daily
from days 1 to 4, and the concentrations of IL-2, IFN- (Th1), and
IL-4 (Th2) were determined by ELISA. The mean concentrations of
secreted lymphokines, at day 1 for IL-2 or day 3 for the others, are
presented in Table 1 and Figure
2 (for IL-2 only). In cells treated with
coated Lptn on CD3 stimulation, the peak levels of IL-2 and IFN-
were reduced 5- and 2-fold, respectively, compared with untreated cells
or cells treated with either RANTES or Lptn antibodies, confirming the
specificity of the Lptn-mediated effect (Table 1). As shown in Figure
2, the down-regulation of IL-2 secretion was also observed though to a
lesser extent (2.5-fold less) in the presence of soluble Lptn. Interestingly, major differences were discerned in the regulation of
Th1 and Th2 lymphokine secretion, because the levels of IL-4 were
totally unaffected by the addition of Lptn from days 1 to 3 (Table 1
and not shown). Except for IL-4 (Table 1 footnote), the secreted
lymphokine levels measured in CD3 and CD28 costimulated cells were
consistently higher than in CD3 activated cells (Table 1) and served as
a positive control.
View larger version (9K):
[in this window]
[in a new window]
| Fig 2.
Both soluble and coated forms of Lptn inhibit IL-2
secretion.
CD4+ T cells were activated with the indicated stimuli, as
described in "Materials and methods." Supernatants (day 1 after
activation) were analyzed by ELISA for IL-2 secretion, as indicated in
footnote of Table 1. The mean concentration values (pg/mL) with SD
between parentheses are derived from 5 independent experiments.
|
|
Because inhibition of CD4+ T-cell proliferation by Lptn
could apparently occur through decreased IL-2 production, we examined whether IL-2R expression could consequently be affected, as already demonstrated.20,39 On exposure to Lptn, only the IL-2R
mAb, of 21 evaluated mAbs directed against T-cell surface markers (as listed in "Materials and methods"), showed a decreased binding to
CD4+ T cells, at day 3 after CD3 stimulation (Figure
3). In the presence of Lptn, an approximate
2-fold reduction in both surface density and percentage of positive
cells for IL-2R was specifically observed, as shown by the complete
reversion by anti-Lptn antibody, the absence of effect of RANTES, and
the increased IL-2R surface density induced by CD28 costimulation
(Figure 3). The lack of variation in the expression of various
adhesion/activation molecules tested (as listed in "Materials and
methods," not shown), in particular of IL-2R (Figure 3) suggested
that the down-regulation of IL-2R expression is probably a
consequence of the reduced IL-2 production by Lptn.
View larger version (31K):
[in this window]
[in a new window]
| Fig 3.
Down-regulation of IL-2R expression by Lptn.
CD4+ T cells were activated for 3 days with the indicated
stimuli, then stained with the FITC- or PE-conjugated mAbs listed in
"Materials and methods," including IL-2R mAb, and analyzed by
FACS. Mean fluorescence intensity (MFI) and percent of
positive cells relative to IL-2R expression are indicated. For
unstimulated cells, these values were 11% and 6%. For IL-2R,
expression of which is not affected by Lptn, they were 8% and 4%
(medium), 17% and 61% (CD3), 16% and 50% (CD3+Lptn), 22% and 71%
(CD3+Lptn+anti-Lptn), 20% and 64% (CD3+RANTES), 17% and 55%
(CD3+RANTES+anti-RANTES). This experiment is 1 among 3 independent
determinations performed with different donors.
|
|
Transcriptional repression contributes to the Lptn-mediated
inhibition of Th1 lymphokine production
Based on these observations, we postulated that the inhibition of
Th1 lymphokine secretion by Lptn occurs at the transcriptional level.
To test this, we performed 2 types of experiments. We first determined
the relative mRNA levels of Th1- but not Th2-type lymphokines by
semiquantitative RT-PCR, using RNA from purified CD4+ T
cells activated for 24 and 48 hours. Representative experiments are
shown in Figure 4A and their
quantification in Figure 4B. As can be seen, mRNA levels of both IL-2
and IFN- were decreased in presence of Lptn, compared to those
without Lptn or with its specific antibody. This reduction was
approximately 55% for IL-2 at day 1 and 60% for IFN- at day 2. However, for both IL-2 and IFN-, the intensity of the Lptn-mediated
inhibition of mRNA expression was variable depending on the donors. Two
types of response were effectively encountered in half of the donors:
either very weak signals resulting in marked reduction of mRNA levels
(60-90%), relative to those measured on CD3 activation alone (Figure
4A), or signals resulting in modest reduction of mRNA levels (20-35%). In contrast to Lptn, under identical conditions there was no
significant effect of RANTES or its specific antibody on the expression
of both mRNAs (Figure 4A, B). Regarding the expression of Th2-type lymphokines, the expression of IL-4 mRNA was barely detectable under
these conditions conversely to that of IL-13, which displayed similar
levels to the conditions of CD3 activation, with or without Lptn (not
shown).
View larger version (114K):
[in this window]
[in a new window]
| Fig 4.
Lptn impairs the induction of Th1 but not Th2 type
genes.
(A) CD4+ T cells were collected after
activation for 24 or 48 hours, followed by RNA extraction, reverse
transcription, and PCR using primer pairs specific for both
Hu2m and IL-2 at 24 hours, and for both
Hu2m and IFN- or IL-13 (not shown for IL-13) at
48 hours, as described in "Materials and methods." One experiment
of 4 is shown for either IL-2 or INF-. (B) Quantification of the
RT-PCR experiments shown in panel A. Integrated intensity of the
respective bands was determined as described in "Materials and
methods." Data shown represent the mean value ± SD (error bar)
of the lymphokine/Hu2m signal ratio, calculated
from 4 different experiments. The expression of IL-13 mRNA gave similar
intensities with or without Lptn (not shown). (C) JA16 cells were
electroporated with pIL-2, pIFN-, or pIL-4-Fluc constructs, together
with p-actin-Rluc, as described in "Materials and methods."
After transfection, cells were either left unstimulated (not shown) or
stimulated overnight as indicated. For each lymphokine promoter
construct and each activation condition, the relative luciferase
activity (RLU) corresponds to the ratio of Fluc expression to that of
Rluc, and each RLU value is representative of at least 3 independent
experiments. RLU obtained for PMA+ionomycin were 123.2 (2.44), 1.77 (0.024), 1.07 (0.81) for pIL-2, pIFN-, pIL-4, respectively, with SD
in parentheses. Whatever the promoter used, RLU of unstimulated cells
was 5- to 15-fold lower than in CD3-stimulated cells (not shown).
|
|
To emphasize the inhibitory role of Lptn in the transcription of Th1
but not Th2-type lymphokine genes, inferred from RT-PCR experiments, we
transfected into Jurkat cells the constructs for IL-2, IFN-, and
IL-4 promoters, linked to firefly luciferase gene and
analyzed luciferase expression, under similar stimulation conditions
(except for duration) as for primary CD4+ T cells.
Consistent with the data from primary cells, CD3-activated Jurkat cells
showed a 2-fold reduction of IL-2 and IFN- promoter induction by
Lptn, whereas the IL-4 promoter induction remained unaffected (Figure
4C). This inhibitory effect was completely abrogated by the addition of
anti-Lptn antibody (Figure 4C), indicative of specificity for Lptn,
that was reinforced by the inability of RANTES or its blocking antibody
to affect these lymphokine promoter-driven luciferase expressions
(Figure 4C). The activity of each promoter was, however, strongly
enhanced by a stimulation driven via a combination of either ionomycin
or CD3 and PMA (Figure 4C). Taken together, our data show that Lptn
impairs Th1 lymphokine secretion at the transcriptional level.
NF-ATc appears to be a target for the Lptn-mediated transcriptional
repression
Because the transcriptional factors NF-AT, NF-kB, and AP-1
are involved in the expression of lymphokine genes, their participation as targets for Lptn was investigated, using luciferase reporter plasmids bearing multiple binding sites for these factors. As shown in
Figure 5A, only NF-AT but neither NF-KB
nor AP-1 activities following CD3 stimulation could be specifically
inhibited by Lptn to an approximate 3.5-fold level, as controlled by
the absence of effect of RANTES and the up-regulation by PMA of the 3 transcription factor activities (Figure 5A). These results suggest that
Lptn could link the signals from CD3/TcR to promoters of lymphokine genes characteristic of Th1 cells, mainly through NF-AT modulation of
activity. Because both NF-ATc and NF-ATp isoforms are highly expressed
in peripheral T cells and strongly activate the IL-2 promoter in
transfection assays,40 we wanted to investigate the
contribution of these individual NF-AT factors to the Lptn-mediated down-regulation of CD3/TcR-induced IL-2 promoter activity. For this
purpose, we cotransfected in Jurkat cells the IL-2 promoter luciferase
reporter plasmid in conjunction with expression vectors for NF-ATc/C or
NF-ATp, and analyzed luciferase expression. As shown in Figure 5B,
NF-ATc/C and NF-ATp expression increased the IL-2 promoter-driven
transactivation induced by CD3 stimulation alone. However, the NF-ATp
expression did not affect the suppression of CD3-mediated IL-2 promoter
induction by Lptn, and the addition of anti-Lptn antibody
restored the IL-2 promoter transcription activity to the
level induced by CD3 stimulation alone (Figure 5B). In contrast, in the
presence of Lptn, NF-ATc/C expression increased the IL-2 promoter
transcription activity above the level induced by CD3 stimulation
alone, and such a restoration was not abrogated by the anti-Lptn
antibody (Figure 5B). As a control of their specificity, the 2 NF-AT
factors displayed a similar transacting activity on the NF-AT but not
the NF-KB-luciferase reporter plasmids (not shown). Altogether these
data suggested that NF-ATc/C could overcome the Lptn-mediated
inhibition of IL-2 promoter transcription and so, appears to be a
better candidate than NF-ATp as a molecular target for Lptn.
View larger version (43K):
[in this window]
[in a new window]
| Fig 5.
NF-AT-but not NF-KB- or AP-1-driven transcription is
strongly reduced by Lptn.
(A) JA16 cells were electroporated with p5xAP-1, p3xNF-AT, or
p2xNF-KB-Fluc constructs, activated with the indicated stimuli for
overnight. Luciferase expression was measured as described above. The
increases in RLU in CD3-stimulated cells as compared with unstimulated
cells were approximately of 10-, 1.5-, and 20-fold for NF-KB, AP-1,
and NF-AT, respectively. Data are representative of at least 4 independent experiments. (B) NF-ATc but not NF-ATp is able to overcome
the Lptn-mediated inhibition of IL-2 promoter-driven transcription.
JA16 cells were cotransfected with 7.5 µg of pIL-2-FLuc and either
the empty pBluescript SK as control (vector), NF-ATp, or NF-ATc/C cDNA
expression vectors at the indicated doses. Relative luciferase activity
(RLU) was measured in cultures activated overnight with the indicated
stimuli, as explained in the legend of Figure 4. Data represent mean
values with SD between brackets (ND = not determined) of 5 independent experiments, except for CD3+Lptn+anti-Lptn, where 2 and 1 experiments were done, respectively, with NF-ATc and NF-ATp.
|
|
The inhibition of Lptn-mediated CD4+ T-cell
proliferation is overcome by IL-2 or the signal transduction
inhibitors, PT, wortmannin, and genistein
Because one mechanism of inhibition of CD4+ T-cell
proliferation by Lptn might be due to a decreased IL-2 production,
experiments were conducted to examine whether exogenous IL-2 might
overcome such an inhibition. Table 2 shows
that this was indeed the case because a complete reversion was observed
of the 2-fold Lptn-mediated inhibition of CD3-induced thymidine uptake
by exogenous IL-2. This reversion was partly abolished by the addition
of IL-2R mAb (Table 2).
In an attempt to decipher putative signal transduction pathways
involved in Lptn-mediated inhibitory effects on CD4+ T-cell
proliferation, we checked a panel of various protein kinase inhibitors,
in addition to PT, an inhibitor of GPCR, the receptor for
Lptn.17 As shown in Table
3, pretreatment with PT completely reversed
the Lptn-mediated inhibition of CD3-induced proliferation, without any
effect on it, in absence of Lptn (not shown). Such a result confirmed
the binding to and signaling of Lptn through Gi class of
G proteins. In addition, both wortmannin and genistein released the
suppressive effects of Lptn, suggesting that wortmannin- and
genistein-sensitive protein kinases are also involved in Lptn signaling
(Table 3).
View this table:
[in this window]
[in a new window]
|
Table 3.
Lptn-mediated inhibition of CD4+ T-cell
proliferation is reversed by pertussis toxin, wortmannin, and
genistein
|
|
Lptn displays a differential activity toward CD4+ and
CD8+ T-cell activation
Based on our observation that Lptn did not affect the proliferation
of unseparated T cells, we examined the effect of Lptn on
CD8+ T cells, by measuring their thymidine uptake as well
as secretion of IL-2 and IL-4. As can be seen in Figure
6, Lptn but not RANTES (not shown) appeared
as a potent protagonist of CD8+ T-cell costimulation,
almost as potent as CD28 costimulation (Figure 6) or exogenous IL-2
(not shown), in increasing thymidine uptake of purified
CD8+ T cells. In the same experiments, Lptn inhibited the
thymidine uptake of CD4+ T cells (Figure 6). In a similar
fashion to that in CD4+ cells, Lptn only affected Th1 but
not Th2 secretion of CD8+ cells, but in this case, by
increasing IL-2 but not IL-4 secretion (Table
4). It is unclear whether this effect could
explain the observed enhancement of CD8+ T-cell
proliferation. Such an opposite effect of Lptn on the proliferation of
CD4+ and CD8+ subsets was totally abrogated by
anti-Lptn Ab (Figure 6), suggesting the specificity of the chemokine,
all the more as CD28 costimulation was confirmed in the same
experiments, to strongly up-regulate the IL-2 secretion in both
subsets, as already known22,23 (Table 4).
View larger version (12K):
[in this window]
[in a new window]
| Fig 6.
Lptn displays a differential activity on
CD4+ and CD8+ T-cell proliferation.
CD4+ or CD8+ T cells were purified and
activated with the indicated stimuli, for 5 days, including overnight
[3H]-thymidine uptake, as described in "Materials and
methods." Results are expressed as stated in legend of Figure 1 and
are representative for each activation condition of 7 and 5 independent
experiments for the CD4+ and CD8+ subsets,
respectively.
|
|
| |
Discussion |
Chemotaxis induced by Lptn is now beginning to be well documented in
different human cell types and in T cells in particular. Besides this
role, no direct effect has been observed for Lptn on T-cell activation.
In the present study, we demonstrate that Lptn acts as a direct
inhibitor of human CD4+ T-cell proliferation and secretion
of Th1 but not Th2 lymphokines. Interestingly, Lptn exerts an opposite
effect on CD8+ proliferation and IL-2 secretion. The
addition of Lptn antibody to CD4+ T cells activated via CD3
alone induced proliferation of similar intensity to that induced by CD3
and CD28 costimulation (not shown). The same tendency of Lptn antibody
was observed toward CD8+ T-cell activation, with an
opposite effect (not shown), suggesting that endogenous Lptn, which is
optimally produced on CD3 stimulation alone in both subsets, as
previously shown by us,31 could also affect T-cell
proliferation, at least in vitro.
Interestingly, the soluble form of Lptn was a bit less potent than the
coated form in inhibiting proliferation or IL-2 secretion. If
aggregation of chemokines seems to be increasingly important for
effective chemokine binding to the rolling leukocytes,41 or
additional activities, the cause for such a difference of efficacy between the 2 forms is not understood. Alternatively, a contribution of
glycosylation in biologic functions of Lptn42 could be
proposed and be partly overcome by the coated form of recombinant Lptn.
Notably, a negative involvement of MIP-1 in murine splenic T-cell
activation was reported,43 through an inhibition of
CD3-induced proliferation and IL-2 production. Lptn did not block the
CD4+ T-cell proliferation induced on CD28 costimulation, in
conjunction with CD2 or CD3 (not shown). This suggested that Lptn
likely interferes most specifically with the TcR complex-associated molecules.
In CD4+ T cells, Lptn highly impairs the secretion of IL-2
and, to a lesser extent, IFN-, but spares that of IL-4. This
observation suggested either a differential activity of Lptn on Th1-
and Th2-type T cells or a differential expression of Lptn receptor on
these subsets, as shown for expression of CC and CXC
receptors.44-46 If so, Lptn, by inhibiting Th1 but not Th2
lymphokine production, could negatively act on the effectors of
cell-mediated immune responses and inflammatory or autoimmune
disorders, without affecting humoral responses. We can speculate that
the reduction in both IFN- secretion and IL-2R but not IL-2R
expression may be consecutive to the great reduction in IL-2
production, which is in agreement with the known up-regulation by IL-2
of IFN- production,47 as well as
IL-2R expression.20,39 Such speculations are reinforced by the ability of exogenous IL-2 to completely overcome the
Lptn-mediated inhibitory effects. As additional consequences, the
reduced production of both IL-2 and IFN- could potentially lead to
down- or up-regulation of expression of both chemokines or their
receptors.48
Although Lptn caused a significant decrease in IL-2 and IFN- mRNA
concentrations, as measured by RT-PCR experiments, the intensity of
reduction varied between the donors and seemed to be insufficient to
explain the intensity of down-regulation of lymphokine secretion by
Lptn, especially of IL-2. This could be explained either by a trivial
kinetics shifting, considering that both mRNA and protein levels for
IL-2 were measured at the same time (24 hours) and that mRNA expression
might have been down-regulated before that of the protein.
Alternatively, it suggested that additional regulatory mechanisms
occurring at posttranscriptional levels could be involved.
This work showed that the Lptn-mediated decreased activities of Th1
(IL-2, IFN-) but not Th2 (IL-4) lymphokine promoter cells was
predominantly associated with a reduced activity of NF-AT but not of
NF-KB or AP-1 activities. The presence of NF-AT49 but
also of NF-KB and AP-1 binding sites in both Th1 and Th2 lymphokine promoters suggested that the Lptn-mediated specificity toward Th1
lymphokines could be ascribed to a complex regulation. Among the 2 main
NF-AT family members expressed predominantly in peripheral T cells, our
data show that NF-ATc but not NF-ATp was able to completely oppose the
inhibitory effect of Lptn on the CD3-mediated IL-2 promoter induction.
The results of transient transfection experiments using NF-AT, NF-KB,
or AP-1 controlled luciferase reporter genes showed that Lptn
suppressed the activity of NF-AT but not of NF-KB or AP-1
transcription factors. This observation appears to contradict the
observations that (1) a luciferase transgene controlled by multiple
NF-AT binding sites appeared approximately 40-fold more active in Th2
than Th1 cells,50 and (2) the synthesis of Th2- but not
Th1-type lymphokines was found to be impaired in NF-ATc-deficient T
lymphocytes.51,52 However, the concentrations of NF-AT
factors do not differ markedly between Th1 and Th2 cells,37 and multiple NF-AT binding sites are located within both the Th1 and
Th2 promoters.40 Thus the interaction of NF-ATc with 1 or several transcription factors controlling Th1 development53 might be a target through which Lptn interferes with the induction of
Th1-type lymphokine genes. Interestingly, the reduced NF-AT-driven transcription induced by Lptn could also negatively influence the
transactivation of IL-2R promoter, as already
reported.54
Multiple signaling pathways can be linked to activation by 1 chemokine.
In the case of Lptn, as expected from the affiliation of its receptor
to the GPCR superfamily,17 and as already demonstrated for
its chemotactic activity, we confirmed the engagement by Lptn of a
signaling pathway linked to G-proteins, through PT-induced reversion of
the inhibition of CD4+ T-cell proliferation, with a plateau
effect between 10 ng/mL and 10 µg/mL of PT (not shown). Antiprotein
kinase C and anti-Jak2 inhibitors have been tested also, with no
detectable effect (not shown). Besides PT, both wortmannin and
genistein also overcome this inhibition, suggesting the existence of
either more than 1 pathway linked to Lptn signaling or a complex
cascade involving both phosphoinositide and tyrosine kinases downstream
or upstream the G-protein coupling of Lptn receptor. In line with these
results, chemotaxis of NK cells induced by Lptn has been shown to be
mediated by a ternary complex including G-proteins, pleckstrin and
PI3K.55 Also in support of this, costimulation of human
T-cell activation by RANTES was reported to require multiple signaling
transducers, involving PT-sensitive G-proteins, and protein tyrosine
kinases.11,56
Several studies in murine models have proposed Lptn as an adjuvant of
immune responses, promoting antitumor immunity through enhancement of
CD8+ T-cell-mediated cytotoxic activity, of
CD4+ T-cell proliferation, and cytokine
production.57-60 The investigation by such studies of these
biologic functions of Lptn on T-cell responses, was analyzed after
systemic administration of the protein, and failed to demonstrate a
direct effect of Lptn on CD4+ or CD8+ T cells.
Hence, in marked contrast to murine studies, our work clearly provides
the first demonstration of a differential regulation of
CD4+ and CD8+ human T-cell activation, provided
directly by a cytokine, belonging to the chemokine superfamily, namely
Lptn. By inhibiting normal CD4+ T-cell activation, Lptn can
be added to the list of well-known negative regulators of T-cell
activation such as CTLA-461 and FasL.62
Furthermore, because Lptn was unable to inhibit IL-2 production in
response to CD3 and CD28 costimulation, a speculative role of Lptn may
be to exert a negative feedback to prevent complete activation of
CD4+ T cells, that might have been inappropriately
stimulated through CD3/TcR alone, contributing to phenomena such as
anergy, apoptosis, and keeping of self-tolerance. The absence of
inhibition seen in the case of CD28-costimulated cells may result from
the poor efficacy of these cells to produce Lptn, as previously shown
by us,31 or from the absence of expression of Lptn receptor
on them. By increasing normal CD8+ T-cell activation, Lptn
potentially represents a new effector of T-cell costimulation, as for
instance exogenous IL-2, remaining, however, much less efficient than
CD28 costimulation in increasing IL-2 production (Table 4). In light of
this, the role played by Lptn in other CD8+ T-cell
responses, such as IFN- production and cytotoxic activity is of
great interest and is actually under investigation.
Cytokines (such as IFN- or IL-4) present during the initiation of a
T-cell response by ligation of the TcR have clearly defined and
opposite functions in determining the polarization of Th subsets, and
then in the different effector responses.63,64 In this context, it remains to be elucidated whether the inhibition of Th1
production by Lptn may also occur after polarization of T cells, in
memory or effector precursor cells. Such key information could help us
to develop applicable approaches to use Lptn in immunologic
intervention, in particular, for replacement of defective T-helper
functions. Our work thus opens up a new field for finely controlled
biologic functions of Lptn in human T lymphocytes.
| |
Acknowledgments |
We are grateful to Y. Collette and R. Castellano for the gift of
pactin-Rluc reporter gene. We thank R. Galindo for technical assistance for FACS analyses.
| |
Footnotes |
Submitted July 12, 1999; accepted March 3, 2000.
Supported by INSERM.
Reprints: Chantal Cerdan, INSERM U119, Université
Méditerranée, 27 Boulevard Leï Roure, 13009 Marseille, France; e-mail: cerdan{at}marseille.inserm.fr.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
| |
References |
1.
Rollins BJ.
Chemokines.
Blood.
1997;90:909[Free Full Text].
2.
Kennedy J, Kelner GS, Kleyensteuber S, et al.
Molecular cloning and functional characterization of human lymphotactin.
J. Immunol.
1995;155:203[Abstract].
3.
Müller S, Dorner B, Korthäuer U, et al.
Cloning of ATAC, an activation-induced, chemokine-related molecule exclusively |
Top
Abstract
Introduction