Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krajinovic, M.
Right arrow Articles by Sinnett, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krajinovic, M.
Right arrow Articles by Sinnett, D.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 93 No. 5 (March 1), 1999: pp. 1496-1501

RAPID COMMUNICATION

Susceptibility to Childhood Acute Lymphoblastic Leukemia: Influence of CYP1A1, CYP2D6, GSTM1, and GSTT1 Genetic Polymorphisms

By Maja Krajinovic, Damian Labuda, Chantal Richer, Sepideh Karimi, and Daniel Sinnett

From Service d'Hématologie-Oncologie, Centre de Cancérologie Charles-Bruneau et Centre de Recherche, Hôpital Sainte-Justine; and Département de Pédiatrie, Université de Montréal, Montréal, Quebec, Canada.


    ABSTRACT
Top
Abstract
Introduction
References

Although acute lymphoblastic leukemia (ALL) is the most common childhood cancer, factors governing susceptibility to this disease have not yet been identified. As such, ALL offers a useful opportunity to examine the glutathione S-transferase and cytochrome P450 genes in determining susceptibility to pediatric cancers. Both enzymes are involved in carcinogen metabolism and have been shown to influence the risk a variety of solid tumors in adults. To determine whether these genes played a similar role in childhood leukemogenesis, we compared the allele frequencies of 177 childhood ALL patients and 304 controls for the CYP1A1, CYP2D6, GSTM1, and GSTT1 genes. We chose the French population of Quebec as our study population because of its relative genetic homogeneity. The GSTM1 null and CYP1A1*2A genotypes were both found to be significant predictors of ALL risk (odds ratio [OR] = 1.8). Those possessing both genotypes were at an even greater risk of developing the disease (OR = 3.3). None of the other alleles tested for proved to be significant indicators of ALL risk. Unexpectedly, girls carrying the CYP1A1*4 were significantly underrepresented in the ALL group (OR = 0.2), suggesting that a gender-specific protective role exists for this allele. These results suggest that the risk of ALL may indeed be associated with xenobiotics-metabolism, and thus with environmental exposures. Our findings may also explain, in part, why ALL is more prevalent among males than females.
© 1999 by The American Society of Hematology.


    INTRODUCTION
Top
Abstract
Introduction
References

ACUTE LYMPHOBLASTIC leukemia (ALL) is the most frequent cancer found among children. ALL is a heterogeneous disease characterized by the predominance of lymphoblasts or immature hematopoietic precursors, in which malignant cells express diverse phenotypes and respond variably to chemotherapy. Despite much investigation, little is known about leukemogenesis, particularly with respect to issues such as the role of inherited genetic susceptibility and environmental factors, although the clinical, pathological, and immunophenotypic features of the disease are well documented.1 To date, epidemiological studies have failed to find any reproducible, significant associations between ALL and either genetic or environmental factors.2-4

It has been suggested that individuals possessing a modified ability to metabolize carcinogens are at increased risk of cancer.5 Thus, polymorphisms in genes encoding carcinogen-metabolizing enzymes may have relevance in determining susceptibility to cancer---individuals carrying the more active form of an enzyme involved in the activation of carcinogens, or less efficient alleles of detoxifying enzymes, will be at greater risk of cancer. For this reason, two families of genes have attracted interest: phase I cytochromes P-450 (CYPs) and phase II glutathione-S-transferases (GSTs).

Genetic variants have been described in whites in both the CYP1A16-8 and CYP2D69 genes. Furthermore, a significant number of individuals lacking GSTM1 and GSTT1 activity display homozygous deletion (null allele) at the corresponding gene locus.10,11 Several studies have reported associations between these variants and altered risk of a variety of cancers, including those of the lung, bladder, gastrointestinal tract, skin, cervix, and breast.12-16 The prevalence of each polymorphism varies greatly among different ethnic groups, as well as within the white population.17,18 Because such variation can influence the power and interpretation of epidemiological data, it would seem that the study of a more homogeneous patient population is needed. We propose that the Canadian population originating from the Province of Quebec (~80% of French origin), well known for the presence of founder effect,19 constitutes an ideal genetic model for carrying out such epidemiological studies.

In this study, we used a polymerase chain reaction (PCR)-based genotyping approach to examine the relationship between genetic polymorphisms in GSTM1, GSTT1, CYP1A1, and CYP2D6, and susceptibility to childhood ALL in the French-Canadian population. We report the analysis of these loci in 177 ALL patients and in 304 controls.


    MATERIALS AND METHODS

Subjects

Childhood ALL patients (n = 177) were diagnosed in the Division of Hematology-Oncology of Ste-Justine Hospital, Montréal, between August 1988 and September 1997. The criteria for inclusion in this group were: (1) Complete clinical history; (2) whites of French-Canadian origin residing in the Province of Quebec as judged by their names, languages, and places of birth; (3) availability of biological material. The recruited patients comprised 110 males and 67 females between the ages of 1 and 21 years (mean age, 8 ± 4.9). The distribution of ALL subtypes as determined by immunophenotyping was as follows: 137 pre-B ALL, 20 T-cell ALL, and 20 with undetermined lineage. A general population control group composed of 144 males and 160 females was randomly selected from a large DNA institutional bank. The criteria for inclusion in the control group were: (1) anonymous, healthy, and unrelated individuals recruited from the population served by Ste-Justine Hospital; (2) whites of French-Canadian origin residing in the Province of Quebec as judged by their language and place of birth. The research protocol was approved by the Institutional Review Board (Hospital Ste-Justine, University of Montréal) and informed consent was obtained from all participating individuals and/or their parents involved in the study.

Genotyping

DNA isolation.   DNA was isolated from either buccal epithelial cells, peripheral blood, or bone marrow in remission, as described by Baccichet et al.20

GSTM1 polymorphism.   The polymorphic deletion of the GSTM1 gene was genotyped using the multiplex PCR approach described by Zhong et al.12 The PCR primers used were as follows: P1, 5' CGCCATCTTGTGCTACATTGCCCG; P2, 5' ATCTTCTCCTCTTCTGTCTC; and P3, 5' TTCTGGATTGTAGCAGATCA. P1 and P3 amplify a 230-bp product that is specific to GSTM1, whereas P1 and P2 anneal to GSTM1 and GSTM4 genes, yielding a 157-bp fragment that serves as an internal control. PCR was performed in 20 µL containing 20 ng of genomic DNA, 0.5 µmol/L of each primer, 200 µmol/L of each dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 1.5 mmol/L MgCl2, and 0.5 U of ampliTaq DNA polymerase (Hoffman-LaRoche, Branchburg, NJ). After denaturation for 4 minutes at 94°C, the PCR was performed for 35 cycles of 30 seconds at 94°C, 1 minute at 58°C, and 1 minute at 72°C. The last elongation step was extended to 7 minutes. Negative and positive control samples were included in each amplification series. The presence of one or both GSTM1 allele, identified by a 230-bp fragment, or its complete deletion (null genotype), was analyzed by electrophoresis on a 1.2% agarose gel. The absence of amplifiable GSTM1 (in the presence of the GSTM4 coamplified control) indicates a null genotype.

GSTT1 polymorphism.   The polymorphic deletion of the GSTT1 gene was determined by a modification of the PCR protocol described by Katoh et al.21 The amplification reaction was performed in 20 µL containing 20 ng of genomic DNA, 0.5 µmol/L of each primer, 200 µmol/L of each dNTPs, 2.0 mmol/L MgCl2, 10 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, and 0.5 U ampliTaq DNA polymerase (Hoffman-LaRoche). The primers used to amplify GSTT1 were F46, 5' GCCCTGGCTAGTTGCTGAAG and R137, 5' GCATCTGATTTGGGGACCACA. A 268-bp fragment in the exon 1 of beta -globin gene was coamplified with the primers BgloF, 5' CAACTTCATCCACGTTCACC and BgloR, 5' GAAGAGCCAAGGACAGGTAC as a control. The PCR was performed for 35 cycles of 15 seconds at 94°C, 30 seconds at 59°C, and 45 seconds at 72°C. The last elongation step was extended to 7 minutes. Negative and positive control samples were included in each amplification series. The presence of one or two GSTT1 alleles, identified by a 112-bp fragment, or its complete deletion (null genotype), was shown by electrophoresis on a 1.5% agarose gel. GSTT1 genotypes were scored only if the PCR signal corresponding to the beta -globin internal control was evident.

CYP1A1 polymorphisms.   CYP1A1 mutations T6235C (m1), A4889G (m2), and C4887A (m4) were characterized by the PCR-RFLP approach of Cascorbi et al.8 A DNA fragment of 899 bp was amplified in 20 µL containing 20 ng of genomic DNA, 0.5 µmol/L of primers M3F (5' GGCTGAGCAATCTGACCCTA) and P80 (5' TAGGAGTCTTGTCTCATGCCT), 200 µmol/L dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 2.5 mmol/L MgCl2, 50 mmol/L KCl, and 0.5 U AmpliTaq DNA polymerase (Hoffman-LaRoche). PCR was performed for 35 cycles of 30 seconds at 94°C, 1 minute at 63°C, and 1 minute at 72°C. The PCR product (5 to 10 µL) was digested with Msp1 (3 U, 37°C), resulting in smaller fragments (693 and 206 bp) in case of the mutation, and subjected to electrophoresis on a 1.5% agarose gel. Mutations m2 and m4 were detected by amplifying a 204-bp fragment with primers M2F (5' CTGTCTCCCTCTGGTTACAGGAAGC) and M2R (5' TTCCACCCGTTGCAGCAGGATAGCC) as described above, followed by digestion with BsrDI (1 U, 65°C) and BsaI (2 U, 55°C), respectively. Both restriction sites were lost in the case of mutation and the resulting restricted fragments were evaluated on a 2.0% agarose gel. These mutations were then used to define three distinct alleles, CYP1A1*2A (presence of m1 only), *2B (both m1 and m2), and *4 (m4 only).

CYP2D6 polymorphisms.   The mutant CYP2D6*4 (G-to-A transition at position 1934) and CYP2D6*3 (a 1-bp deletion in position 2637) alleles were detected by PCR amplification using exon3/intron4 primers (forward, 5' GCCTTCGCCAACCACTCCG; reverse, 5' AAATCCTGCTCTTCCGAGGC) followed by BstNI digestion (3 U at 60°C), and primers to exon 5/intron 5 (forward, 5' GATGAGCTGCTAACTGAGCCC; reverse, 5' CCGAGAGCATACTCGGGAC), followed by HpaII digestion (3 U, 37°C), respectively.22 PCR was performed for 35 cycles of 30 seconds at 94°C, 45 seconds at 56°C (*3) or 60°C (*4), and 45 seconds at 72°C in 20 µL containing 20 ng of genomic DNA, 1.0 µmol/L of each primer, 200 µmol/L dNTPs, 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 50 mmol/L KCl, and 0.5 U AmpliTaq DNA polymerase (Hoffman-LaRoche). The PCR product (10 µL) was digested with the corresponding restriction enzyme and subjected to electrophoresis on a 2.0% agarose gel.

Statistical Analysis

The statistical significance of the differences between groups was calculated using the Fisher exact test (two-sided). Crude odds ratios (ORs) were calculated and are given within 95% confidence intervals (CI). Unconditional multivariate logistic analyses were performed separately for each locus. Age and gender were included as covariables, as were all genotypes studied and possible interactions. Individuals having the null genotype for GSTM1 and GSTT1, who were homozygous for CYP2D6 variant and/or carriers of at least one CYP1A1 mutant allele, were considered at risk. All analyses were performed using an SPSS statistical package (version 7.5) (SPSS Inc, Chicago, IL). The fraction of the disease attributable to a given genotype was estimated according to Coughlin et al.23


    RESULTS

DNA of a quality suitable for PCR was available from 177 whites of French-Canadian origin diagnosed with ALL and 304 healthy controls of a similar ethnic background. Some individuals were not successfully genotyped for all mutations tested, thus explaining the variations in the total number of samples listed in tables 1 to 5. Both pre-B and T-cell ALLs were considered part of the same group because no significant differences were observed in terms of the tested genotypes (data not shown). The frequency of CYP1A1 and CYP2D6 alleles, as well as the distribution of GSTM1, GSTT1, CYP1A1, and CYP2D6 genotypes in ALL patients and in controls are given in Tables 1 and 2, respectively. The observed prevalence of these mutations is in accordance with data from other studies of groups of whites.9,24-26

                              
View this table:
[in this window]
[in a new window]
  		Table 1. Frequency of CYP1A1 and CYP2D6 Alleles in ALL Patients and Controls


                              
View this table:
[in this window]
[in a new window]
  		Table 2. Distribution of CYP1A1, CYP2D6, GSTM1, and GSTT1 Genotypes in ALL Cases and Controls

The incidence of GSTM1 null and CYP1A1*2A genotypes were significantly increased in ALL cases as compared with controls (Tables 1 and 3). Among ALL patients, 64.9% were homozygous for the GSTM1 null genotype, compared with 51.3% of controls, and CYP1A1*2A individuals account for 19.4% of ALL cases, compared with 11.7% of controls (Table 2). Consequently, there was an 80% increase in the risk of ALL associated with the GSTM1 null genotype (OR = 1.8; 95% CI, 1.2-2.6) and CYP1A1*2A allele (OR = 1.8; 95% CI, 1.1-3.1) (Table 3). These data indicate that the absence of the GSTM1 gene and the presence of the CYP1A1*2A allele are associated with an increased risk of ALL in this group of patients. An increase in the frequency of CYP2D6 poor metabolizer was observed in children with ALL compared with controls (Table 2), but the difference was not statistically significant (Table 3). None of the other variants studied proved to be significant predictors of ALL risk (Table 3).

                              
View this table:
[in this window]
[in a new window]
  		Table 3. Relationship Between CYP1A1, CYP2D6, GSTM1, and GSTT1 Genotypes and Risk of Childhood ALL

A multivariate analysis using unconditional logistic regression was performed to determine which of the variables (gender, age, GSTM1, GSTT1, CYP1A1, and CYP2D6) continued to show significant differences between cases and controls in the presence of the others. Multivariate OR for GSTM1 and CYP1A1*2A were 1.8 (95% CI = 1.2-2.8) and 2.1 (95% CI = 1.2-3.8), respectively. Because GSTM1 is involved in the detoxification of compounds activated by CYP1A1, and both of these enzymes were shown to act independently as ALL risk factors (Table 3), we investigated whether this risk was further increased when both genotypes were combined. When individuals without either of the risk-elevating genotypes were considered as the reference group (ie, those with GSTM1 present and without the CYP1A1*2A allele), we found an increased risk of ALL (OR = 3.3, 95% CI = 1.6-6.9) in children carrying both genotypes at risk (Table 4). The proportion of the disease attributable to CYP1A1*2A and GSTM1 null genotypes alone was estimated to 3% and 19%, respectively, whereas the combined CYP1A1 and GSTM1 risk-elevating genotypes contributed for 8%.

                              
View this table:
[in this window]
[in a new window]
  		Table 4. Combined Effects of GSTM1 Null Genotype and CYP1A1*2A Allele in Childhood ALL Risk

Stratified analysis showed the surprising result that girls carrying at least one CYP1A1*4 allele were significantly underrepresented in the ALL group (OR = 0.2; 95% CI, 0.05-0.9) suggesting a gender-specific protective role against ALL for this allele (Table 5). No other significant synergistic or antagonist statistical interactions between any other combinations of the variables studied here were observed.

                              
View this table:
[in this window]
[in a new window]
  		Table 5. CYP1A1*4 Genotype and Gender-Related Risk of Childhood ALL


    DISCUSSION

Little attention has been paid to the role of genetic susceptibility in the aetiology of childhood ALL. It is thought that genetic factors and environmental exposures predispose children to leukemogenesis. The fact that the etiology of sporadic cancers cannot be explained by allelic variability at a single locus is in part due to the complexity of xenobiotics metabolism in cancer. This study presents the first combined analysis of loci encoding both phase I and II xenobiotic-metabolizing enzymes in a pediatric cancer and, as such, it represents an important contribution.

We determined the frequencies of CYP1A1, CYP2D6, GSTM1, and GSTT1 gene polymorphisms in a particular white population of French-Canadian origin. This population is well known for the presence of founder effect indicating a relative genetic homogeneity due to particular demographic and historic characteristics.19 The overall frequencies of the tested genotypes in control subjects agreed with those reported in other studies.9,24-26 However, in the case of the CYP1A1*4 variant, there seems to be a difference between the frequency observed in French-Canadians (5.1%) and that found in other white populations (2% to 3%).8,26 We have shown that children carrying the GSTM1 null genotype are at increased risk of developing ALL (OR = 1.8). Glutathione S-transferases are involved in the metabolism of a wide range of xenobiotics, including environmental carcinogens, chemotherapeutic agents, and reactive oxygen species.27,28 Several epidemiologic studies have associated the null genotype of GSTM1 with a higher risk of cancer in adults11---this is probably related to an inability to metabolize tobacco-related carcinogens, such as benzo(a)pyrene.29 The only other study analyzing the GST genotypes in the context of ALL risk reported that the double-null genotype for GSTM1 and GSTT1 was significantly more frequent among blacks with childhood ALL, but failed to show that an increased risk was associated with this genotype in whites.30 This discrepancy may be the result of an ethnically heterogeneous population, as great variations in allele frequency are observed both among and within different ethnic groups.24,25

Children carrying the CYP1A1*2A allele are also at greater risk of developing ALL (OR = 1.8). To our knowledge, this is the first report of an association between a CYP1A1 variant and the risk of childhood ALL. The CYP1A1*2A allele is associated with elevated enzymatic activity,8,17 supporting the hypothesis linking the risk of ALL with the inducibility of the xenobiotics-metabolizing enzyme CYP1A1.31 Consequently, carriers of variant alleles are expected to be at a greater risk when exposed to carcinogens such as PAH.6 Indeed, an association between the induction of placental CYP1A1 activity and PAH in cigarette smoke or cooked foods has been reported.32-35 We cannot rule out the possibility that CYP1A1*2A result is due to chance in the context of multiple testing. However, the influence of this genotype is more obvious when other variants participated in the effect.

The presence of both the CYP1A1*2A allele and the GSTM1 null-genotype confers an additional risk of ALL (OR = 3.3) on the carriers. Similar studies performed in adults with nonhematological neoplasias provide further evidence for an increase in the risk of cancer in patients carrying both CYP1A1- and GSTM1-risk alleles.36,37 This is supported biologically by a recent study showing that the combination of CYP1A1 and GSTM1 genotypes clearly affects the formation of DNA adducts in human white blood cells.38 Finally, our results suggest that allelism in CYP2D6 and GSTT1 genes do not play an important role in the aetiology of ALL. However, more data are needed to confirm these findings.

The scarcity of molecular epidemiology studies in childhood diseases makes it difficult to predict how these genotypes at risk will modify the host response to different exposures. Epidemiologic studies have led to the suggestion that in utero and postnatal exposures to various biological, physical, and chemical factors may be important determinants of childhood ALL.39-41 The apparent association of parental exposures to various chemicals31,42-46 suggests that variability at loci encoding xenobiotic-metabolizing enzymes could influence susceptibility to this disease. Infants and children may be at greater risk than adults from a variety of environmental toxicants, including polycyclic aromatic hydrocarbons (PAHs), nitrosamines, pesticides, tobacco smoke, and air pollution due to differential exposure and/or physiologic immaturity.41,47 Xenobiotics enter the placenta through maternal circulation,48 which possesses the ability to metabolize these compounds through processes similar to those seen in the liver.34,49 Therefore, alterations in placental metabolizing capabilities could potentially result in the exposure of the developing foetus to harmful electrophiles. As a target of damage from ubiquitous exposures to xenobiotics, a young child (or fetus) with either the null GSTM1 genotype and/or the CYP1A1*2A allele will be at greater risk of ALL. In this regard we found that 8% of the disease is attributable to combined CYP1A1 and GSTM1 genotypes at risk, whereas GSTM1 null and CYP1A1*2A genotypes alone contributed to 19% and 3%, respectively. These results suggest that the effect of CYP1A1*2A to ALL susceptibility depends on the presence of other genotypes at risk.

As stated earlier, the fact that CYP1A1*4 allele is underrepresented among ALL females suggested a gender-specific protective role for this allele. This finding could partly explain the higher prevalence of ALL in males.50-52 Unlike gender-related hormonal factors that play an obvious role in breast cancer, other sources of variation in cancer risk due to gender have received little attention. The gene product of CYP1A1*4 may be transcriptionally induced or regulated by certain endogenous steroids or other nongenetic factors in females or males. Studies on animals have shown that exogenous agents may permanently affect the expression patterns of specific cytochromes P450.53 Such imprinting of sex-specific cytochrome P450 forms is controlled by the levels and modes of excretion of androgens, estrogens, and growth hormone.54 Unfortunately, the biological significance of the *4 mutation due to C-to-A transversion at position 4887 in the heme-binding domain of exon 7 (threonine exchange to asparagine in codon 461) is still unknown.8 However, we cannot exclude the role of an adjacent gene in linkage with CYP1A1 whose particular allele in association with *4 mutation could be responsible for the effect observed. Because the human fetus and embryo are exposed to numerous chemicals throughout gestation, it is theoretically possible that the imprinting of cytochrome P450 enzymes also occurs.


    ACKNOWLEDGMENT

We are grateful to Dr Claire Infante-Rivard for helpful discussion on the epidemiology and biostatistics aspects of this work. We thank Hugues Sinnett for his excellent technical assistance. We are grateful to all patient and control subjects who participated in this study as well as the physicians and staff for their collaboration.


    FOOTNOTES

Submitted September 29, 1998; accepted December 14, 1998.

Supported by the Fondation Charles-Bruneau and Power Corporation Inc/Fondation Hôpital Ste-Justine. D.S. is a scholar of the Fonds de la Recherche en Santé du Québec.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact.

Address reprint requests to Daniel Sinnett, PhD, Centre de Cancérologie Charles Bruneau, Hôpital Sainte-Justine, 3175 Côte Ste-Catherine, Montréal, Québec, H3T 1C5 Canada; e-mail: sinnettd{at}ere.umontreal.ca.


    REFERENCES
Top
Abstract
Introduction
References

1. Champlin R, Gale RP: Acute lymphoblastic leukaemia: recent advances in biology and therapy. Blood 73:2051, 1989[Free Full Text]

2. Linet MS: The Leukemias: Epidemiologic Aspects. New York, NY, Oxford University Press, 1985.

3. Pendergrass TW: Epidemiology of acute lymphoblastic leukaemia. Semin Oncol 12:80, 1985[Medline] [Order article via Infotrieve]

4. Greaves MF: Speculations on the cause of childhood acute lymphoblastic leukaemia. Leukaemia 2:120, 1988[Medline] [Order article via Infotrieve]

5. Perera FP: Molecular epidemiology: Insights into cancer susceptibility, risk assessment, and prevention. J Natl Cancer Inst 88:496, 1996[Abstract/Free Full Text]

6. Kawajiri K, Nakachi K, Imai K, Yoshii A, Shinoda N, Watanabe J: Identification of genetically high risk individuals to lung cancer by DNA polymorphisms of the cytochrome P450IAI gene. FEBS Lett 263:131, 1990[Medline] [Order article via Infotrieve]

7. Hayashi SI, Watanabe J, Nakachi K, Kawajiri K: Genetic linkage of lung cancer-associated Msp1 polymorphism with amino acid replacement in the heme binding region of the human cytochrome P4501A1 gene. J Biochem 110:407, 1991[Abstract/Free Full Text]

8. Cascorbi I, Brockmöller J, Roots I: A C4887A polymorphism in exon 7 of human CYP1A1: Population frequency, mutation linkages, and impact on lung cancer susceptibility. Cancer Res 56:4965, 1996[Abstract/Free Full Text]

9. Sachse C, Brockmöller J, Bauer S, Roots I: Cytochrome P450 2D6 variants in a caucasian population: Allele frequencies and phenotypic consequences. Am J Hum Genet 60:284, 1997[Medline] [Order article via Infotrieve]

10. Chenevix-Trench G, Young J, Coggan M, Board P: Glutathione S-transferase M1 and T1 polymorphisms: Susceptibility to colon cancer and age onset. Carcinogenesis 16:1655, 1993[Abstract/Free Full Text]

11. Rebbeck TR: Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev 6:733, 1997[Abstract/Free Full Text]

12. Zhong S, Wyllie AH, Barnes D, Wolf CR, Spurr NK: Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer. Carcinogenesis 14:1821, 1993[Abstract/Free Full Text]

13. Alexandrie AK, Sundberg MI, Seidegard J, Tornling G, Rannug A: Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: A study on host factors in relation to age at onset, gender, and histological cancer types. Carcinogenesis 15:1785, 1994[Abstract/Free Full Text]

14. Rebbeck T, Rosvold EA, Duggan DJ, Zhang J, Buetow KH: Genetics of CYP1A1: Coamplification of specific alleles by polymerase chain reaction and association with breast cancer. Cancer Epidemiol Biomarkers Prev 3:511, 1994[Abstract]

15. Warwick A, Sarhanis P, Redman CWE, Pemble S, Taylor JB, Ketterer B, Jones P, Alldersea J, Gilford J, Yengi L, Fryer A, Strange RC: Theta class Glutathione S-transferase GSTT1 genotypes and susceptibility to cervical neoplasia: Interactions with GSTM1, CYP2D6 and smoking. Carcinogenesis 15:2841, 1994[Abstract/Free Full Text]

16. Heagerty A, Smith A, English J, Lear J, Perkins W, Bowers B, Jones P, Gilford J, Alldersea J, Fryer A, Strange RC: Susceptibility to multiple cutaneous basal cell carcinomas: Significant interactions between glutathione S-transferase GSTM1 genotypes, skin type and male gender. Br J Cancer 73:44, 1993

17. Cosma G, Crofts F, Currie D, Wirgin I, Toniolo P, Garte SJ: Racial differences in restriction fragment length polymorphisms and messenger RNA inducibility of the human CYP1A1 gene. Cancer Epidemiol Biomarkers Prev 2:53, 1993[Abstract]

18. Taioli E, Crofts F, Trachman J, Demopoulos R, Toniolo P, Garte SJ: Racial differences in CYP1A1 genotype and function. Toxicol Let 77:357, 1995[Medline] [Order article via Infotrieve]

19. Labuda D, Zietkiewicz E, Labuda M: The genetic clock and the age of the founder effect in growing populations: A lesson from French Canadians and Ashkenazim. Am J Hum Genet 61:768, 1997[Medline] [Order article via Infotrieve]

20. Baccichet A, Qualman SK, Sinnett D: Allelic loss in childhood acute lymphoblastic leukaemia. Leuk Res 21:817, 1997[Medline] [Order article via Infotrieve]

21. Katoh T, Nagata N, Kuroda Y, Itoh H, Kawahara A, Kuroki N, Ookuma R, Bell DA: Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) genetic polymorphism and susceptibility to gastric and colorectal adenocarcinoma. Carcinogenesis 9:1855, 1996

22. Smith CAD, Gough AC, Leigh PN, Summers BA, Harding AE, Maraganore DM, Sturman SG, Schapira AH, Williams AC, Spurr NK, Wolf CR: Debrisoquine hydroxylase gene polymorphism and susceptibility to Parkinson's disease. Lancet 339:1375, 1992[Medline] [Order article via Infotrieve]

23. Coughlin SS, Benichou J, Weed DL: Attributable size estimation in case-control studies. Epidemiol Rev 16:61, 1994

24. Lin HJ, Han C-Y, Bernstein DA, Hsiao W, Lin BK, Hardy S: Ethnic distribution of the glutathione Mu 1-1 (GSTM1) null genotype in 1473 individuals and application to bladder cancer susceptibility. Carcinogenesis 15:1077, 1994[Abstract/Free Full Text]

25. Nelson HH, Wiencke JK, Christiani DC, Cheng TJ, Zuo Z-F, Schwartz BS, Lee B-K, Spitz MR, Wand M, Xu X, Kelsey KT: Ethnic differences in the prevalence of the homozygous deleted genotype of glutathione S-transferase theta. Carcinogenesis 16:1243, 1995[Abstract/Free Full Text]

26. Mrozkiewicz PM, Cascorbi I, Brockmöller J, Roots I: CYP1A1 mutations 4887A, 4889G, 5639C and 6235C in the Polish population and their allelic linkage, determined by peptide nucleic acid-mediated PCR clamping. Pharmacogenetics 7:303, 1997[Medline] [Order article via Infotrieve]

27. Hallier E, Schroder KR, Asmuth K, Dommermuth A, Aust B, Goergens HW: Arch Toxicol 68:423, 1994[Medline] [Order article via Infotrieve]

28. Pemble S, Schoeder KR, Spencer SR, Meyer DJ, Hallier E, Bolt HM, Ketterer B, Taylor JB: Human glutathione S-transferase theta (GSTT1): cDNA cloning and the characterization of a genetic polymorphism. Biochem J 300:271, 1994

29. Awasthi YC, Singh SV, Ahmad H, Moller PC: Immunocytochemical evidence for the expression of GST1, GST2, and GST3 gene loci for glutathione S-transferase in human lung. Lung 165:323, 1987[Medline] [Order article via Infotrieve]

30. Chen CL, Liu Q, Pui CH, Rivera GK, Sandlund JT, Ribeiro R, Evans WE, Relling MV: Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia. Blood 89:1701, 1997[Abstract/Free Full Text]

31. Blumer JL, Dunn R, Esterhay MD, Yamashita TS, Gross S: Lymphocyte aromatic hydrocarbon responsiveness in acute leukemia of childhood. Blood 58:1081, 1981[Abstract/Free Full Text]

32. Sesardic D, Pasanen M, Pelkonen O, Boobis AR: Differential expression and regulation of members of the cytochrome P450IA gene subfamily in human tissues. Carcinogenesis 11:1183, 1990[Abstract/Free Full Text]

33. Manchester DK, Jacoby EH: Sensitivity of human placental monooxygenase activity to maternal smoking. Clin Pharmacol Ther 30:687, 1981[Medline] [Order article via Infotrieve]

34. Pasanen M, Pelkonen O: Human placental xenobiotic and steroid biotransformations catalyzed by cytochrome P450, epoxide hydroxylase and glutathione S-transferase activities and their relationship to maternal cigarette smoking. Drug Metab Rev 21:427, 1989-1990[Medline] [Order article via Infotrieve]

35. Whyatt RM, Garte SJ, Cosma G, Bell DA, Jedrychowski W, Wahrendorf J, Randall MC, Cooper TB, Ottman R, Tang D, Tasi W-Y, Dickey CP, Manchester DK, Crofts F, Perera FP: CYP1A1 messenger RNA levels in placental tissue as a biomarker of environmental exposure. Cancer Epidemiol Biomarkers Prev 4:147, 1995[Abstract]

36. Hayashi S, Watanabe J, Kawajiri K: High susceptibility to lung cancer analyzed in terms of combined genotypes of P450IAI and Mu-class glutathione S-transferase genes. Jpn J Cancer Res 83:866, 1992[Medline] [Order article via Infotrieve]

37. Nakachi K, Imai K, Hayashi S, Kawajiri K: Polymorphisms of the CYP1A1 and glutathione S-transferase genes associated with susceptibility to lung cancer in relation to cigarette dose in a japanese population. Cancer Res 53:2994, 1993[Abstract/Free Full Text]

38. Butkiewicz D, Grzybowska E, Hemminki K, Ovrebo S, Haugen A, Motykiewicz G, Chorazy M: Modulation of DNA adduct levels in human mononuclear white blood cells and granulocytes by CYP1A1, CYP2D6 and GSTM1 genetic polymorphisms. Mutat Res 415:97, 1998[Medline] [Order article via Infotrieve]

39. Neglia JP, Robison LL: Epidemiology of the childhood acute leukemias. Pediatr Clin North Am 35:675, 1988[Medline] [Order article via Infotrieve]

40. Linet MS, Devesa SS: Descriptive epidemiology of childhood leukaemia. Br J Cancer 63:424, 1991[Medline] [Order article via Infotrieve]

41. Whyatt RM, Perera FP: Application of biologic markers to studies of environmental risks in children and the developing fetus. Environ Health Perspect 103:105, 1995

42. Severson RK, Buckley JD, Woods WG, Benjamin D, Robison LL: Cigarette smoking and alcohol consumption by parents of children with acute myeloid leukemia: An analysis within morphological subgroups---A report from the childrens cancer group. Cancer Epidemiol Biomarkers Prev 2:433, 1993[Abstract]

43. Lowengart RA, Peters JM, Cicioni C, Buckley J, Bernstein L, Preston-Martin S, Rappaport E: Childhood leukemia and parents' occupational and home exposures. J Natl Cancer Inst 79:39, 1987

44. Leiss JK, Savitz DA: Home pesticide use and childhood cancer: A case-control study. Am J Public Health 85:249, 1995[Abstract/Free Full Text]

45. Daniels JL, Olshan AF, Savitz DA: Pesticides and childhood cancers. Environ Health Perspect 105:1068, 1997[Medline] [Order article via Infotrieve]

46. Buckley JD, Buckley CM, Ruccione K, Sather HN, Waskerwitz MJ, Woods WG, Robison LL: Epidemiological characteristics of childhood acute lymphocytic leukemia. Analysis by immunophenotype. The childrens' cancer group. Leukemia 8:856, 1994[Medline] [Order article via Infotrieve]

47. Perera FP: Environment and cancer: Who are susceptible? Science 278:1068, 1997[Abstract/Free Full Text]

48. Hakkola J, Pelkonen O, Pasanen M, Raunio H: Xenobiotic-metabolizing cytochrome P450 enzymes in the human feto-placental unit: Role in intrauterine toxicity. Crit Rev Toxicol 28:35, 1998[Medline] [Order article via Infotrieve]

49. Juchau MR: Drug biotransformation in the placenta. Pharcol Ther 8:501, 1980[Medline] [Order article via Infotrieve]

50. Hernandez JA, Land KJ, McKenna RW: Leukemias, myeloma, and other lymphoreticular neoplasms. Cancer 75:381, 1995[Medline] [Order article via Infotrieve] (suppl)

51. Chessells JM, Richards SM, Bailey CC, Lilleyman JS, Eden OB: Gender and treatment outcome in childhood lymphoblastic leukaemia: Report from the MRC UKALL trials. Br J Haematol 89:364, 1995[Medline] [Order article via Infotrieve]

52. Sandler DP, Ross JA: Epidemiology of acute leukemia in children and adults. Semin Oncol 24:3, 1997[Medline] [Order article via Infotrieve]

53. Fujita I, Sindhu RK, Kikkawa Y: Hepatic cytochrome P450 enzyme imprinting in adult rat by neonatal benzo[a]pyrene administration. Pediatr Res 37:646, 1995[Medline] [Order article via Infotrieve]

54. Zaphiropoulos PG, Mode A, Norstedt G, Gustafsson JA: Regulation of sexual differentiation in drug and steroid metabolism. Trends Pharmacol Sci 10:149, 1989[Medline] [Order article via Infotrieve]

© 1999 by The American Society of Hematology.
 
0006-4971/99/9305-0040$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Radiat Prot DosimetryHome page
A. P. Chokkalingam and P. A. Buffler
Genetic susceptibility to childhood leukaemia
Radiat Prot Dosimetry, December 1, 2008; 132(2): 119 - 129.
[Abstract] [Full Text] [PDF]

Home page
 haematolHome page
P. Bolufer, M. Collado, E. Barragan, J. Cervera, M.-J. Calasanz, D. Colomer, J. Roman-Gomez, and M. A. Sanz
The potential effect of gender in combination with common genetic polymorphisms of drug-metabolizing enzymes on the risk of developing acute leukemia
Haematologica, March 1, 2007; 92(3): 308 - 314.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. Healy, H. Belanger, P. Beaulieu, M. Lariviere, D. Labuda, and D. Sinnett
Promoter SNPs in G1/S checkpoint regulators and their impact on the susceptibility to childhood leukemia
Blood, January 15, 2007; 109(2): 683 - 692.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
P. Vigano, E. Somigliana, I. Chiodo, A. Abbiati, and P. Vercellini
Molecular mechanisms and biological plausibility underlying the malignant transformation of endometriosis: a critical analysis
Hum. Reprod. Update, January 1, 2006; 12(1): 77 - 89.
[Abstract] [Full Text] [PDF]

Home page
 Am J EpidemiolHome page
L. F. Masson, L. Sharp, S. C. Cotton, and J. Little
Cytochrome P-450 1A1 Gene Polymorphisms and Risk of Breast Cancer: A HuGE Review
Am. J. Epidemiol., May 15, 2005; 161(10): 901 - 915.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
S. Selvin
Cytochrome P450 1A1 Polymorphism and Childhood Leukemia: An Analysis of Matched Pairs Case-Control Genotype Data
Cancer Epidemiol. Biomarkers Prev., August 1, 2004; 13(8): 1371 - 1374.
[Abstract] [Full Text] [PDF]

Home page