Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, J. E.
Right arrow Articles by Liebhaber, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, J. E.
Right arrow Articles by Liebhaber, S. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 9 (November 1), 1998: pp. 3057-3063

RAPID COMMUNICATION

Reversal of Lethal alpha - and beta -Thalassemias in Mice by Expression of Human Embryonic Globins

By J. Eric Russell and Stephen A. Liebhaber

From the Departments of Medicine (Hematology/Oncology), Pediatrics (Hematology), and Genetics, and the Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, Philadelphia.


    ABSTRACT
Abstract
Introduction
Methods
Results
Discussion
References

Genetic mutations that block alpha - or beta -globin gene expression in humans can result in severe and frequently lethal thalassemic phenotypes. Homozygous inactivation of the endogenous alpha - or beta -globin genes in mice results in corresponding thalassemic syndromes that are uniformly fatal in utero. In the current study, we show that the viability of these mice can be rescued by expression of human embryonic zeta - and &b.epsi;-globins, respectively. The capacity of embryonic globins to fully substitute for their adult globin homologues is further demonstrated by showing that zeta - and &b.epsi;-globins reverse the hemolytic anemia and abnormal erythrocyte morphology of mice with nonlethal forms of alpha - and beta -thalassemia. These results illustrate the potential therapeutic utility of embryonic globins as substitutes for deficient adult globins in thalassemic individuals. Moreover, the capacity of embryonic globins to functionally replace their adult homologues brings into question the physiologic basis for globin gene switching.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
Results
Discussion
References

MOLECULAR DEFECTS that affect the level of alpha - or beta -globin expression result in a collection of clinically heterogeneous disorders known as alpha - and beta -thalassemias, respectively.1-3 As a group, thalassemias comprise the most common genetic defects in humans, with a particularly high prevalence in certain Mediterranean, central African, and south Asian populations.2-4 Clinically significant thalassemias are also increasingly recognized in members of many North American immigrant communities.5 The phenotypes of specific thalassemic mutations are directly proportional to the quantitative deficits in globin gene expression and the resulting imbalance in alpha :beta -chain synthesis. Severe forms of thalassemia are characterized by retarded growth and development resulting from a marked hemolytic anemia, with a compensatory expansion of hematopoietic tissues and a consequent hypermetabolic state.1-3 Complete loss of alpha -globin gene expression results in mid-gestational fetal demise (alpha -thalassemia hydrops fetalis),5 while complete loss of beta -globin expression (beta -thalassemia major) is lethal in untreated children.2,3 Therapeutic options for severely affected individuals are limited to allogeneic bone marrow transplantation (BMT) or lifelong transfusions, neither of which is universally available and both of which are attended by significant cost and risk.6-8

Two alpha -like and two beta -like globin chains assemble into functional hemoglobin (Hb) heterotetramers that reversibly and cooperatively bind four O2 molecules under physiologic conditions. The expression profile of the constituent globin monomers is developmentally regulated. There are three functional alpha -like globin genes in both mouse and humans: zeta , alpha 2, and alpha 1. Expression of human zeta -globin is specific to the primitive, nucleated erythroblasts in the blood islands of the extraembryonic yolk sac.9,10 As the site of active erythropoiesis migrates to the fetal liver, there is silencing of the zeta -globin gene and reciprocal induction of the two alpha -globin genes, which continue to express at high levels into adulthood. The human beta -like globins are encoded by an embryonic epsilon -globin gene, expressed in yolk sac erythroblasts, two fetal gamma -globin genes, and a beta -globin gene that is maximally induced at birth and encodes almost 98% of the beta -like globin chains in normal adult erythrocytes.1,9,11 Coordinate switching of genes within the alpha - and beta -globin clusters results in the sequential assembly of characteristic Hbs during embryonic (zeta 2epsilon 2), fetal (alpha 2gamma 2), and adult (alpha 2beta 2) developmental stages. The major evolutionary factor driving wide phylogenic conservation of this system is unknown, although developmental stage-specific Hbs may optimize O2 delivery to embryonic, fetal, and adult tissues.

The presence of developmentally silenced, yet structurally intact, globin genes in the alpha - and beta -globin clusters suggests a potential therapeutic approach to severe forms of thalassemia based on reactivation of these "back-up" loci. Hypothetically, globin chains expressed from these embryonic and fetal loci could substitute for their deficient adult globin homologues in individuals with severe thalassemias. This approach would be useful only if the Hbs assembling from existing adult and reactivated embryonic globin subunits (eg, Hbs zeta 2beta 2 and alpha 2epsilon 2) were functional in adult (definitive) erythrocytes. The feasibility of this approach is demonstrated by the phenotypic reversion in individuals with beta -thalassemia who overexpress fetal gamma -globin, assembling functional Hb alpha 2gamma 2.2,12 The capacity of embryonic epsilon -globin to substitute for its adult beta -globin homologue in definitive erythrocytes has not previously been explored. Likewise, the possibility that embryonic zeta -globin might substitute for adult alpha -globin, which has no fetal homologue, has never been investigated.

A major concern about stage-discordant globin substitution is the likelihood that Hbs incorporating embryonic subunits would be physiologically irrelevant in definitive erythrocytes. The widely held model in which developmental globin switching reflects some crucial difference between the functions of embryonic and adult globins predicts that Hbs assembled from embryonic subunits should perform poorly in adult erythrocytes. Recent studies demonstrating that these Hbs exhibit substantially elevated O2 affinities in vitro appear to support this model.13,14 However, these predictions do not account for adaptive mechanisms that permit adults expressing mutant Hbs with a wide spectrum of O2-binding affinities to grow and develop normally, and to sustain normal pregnancies.15,16 For these reasons, in vivo assessments may prove to be more valuable predictors of embryonic globin function.17 In the current work, we demonstrate the capacity of human embryonic zeta - and epsilon -globins to reverse the phenotypes of adult alpha - and beta -thalassemic mice, by substituting for deficient alpha -and beta -globin chains, respectively. Moreover, we show that zeta - and epsilon -globins maintain viability in mice with homozygous lethal inactivation of their endogenous adult globin genes, respectively. The data indicate that embryonic globins can function efficiently in vivo in definitive erythrocytes, providing a rational basis for the design of novel therapies aimed at their reactivation in individuals with clinically-severe thalassemias.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
Results
Discussion
References

Transgene construction.   A 2.4-kb human (h) zeta  transgene, comprising a 0.6-kb human alpha -globin promoter fragment linked to the 1.8-kb zeta -globin transcribed region and proximal 3' flanking region, was constructed as previously described.18 A 4.1-kb hepsilon transgene was constructed using a two-step splice-overlap-extension/polymerase chain reaction synthesis,19 in which the 1.5-kb hepsilon transcribed region was inserted between 0.8-kb and 1.7-kb fragments containing the hbeta promoter and enhancer elements, respectively.20 The hzeta and hepsilon transgenes were inserted into polylinker EcoRI and Cla I/EcoRV sites of plasmid pSP72/beta LCR, respectively, immediately adjacent to a 6.5-kb DNA fragment containing core elements of the human beta -globin LCR DNase I hypersensitive sites 1-4.18,21 All polymerase chain reaction (PCR)-amplified fragments were subsequently verified by dideoxy sequencing.22 Linked 8.9-kb µbeta LCR/hzeta and 10.6 kb µbeta LCR/hepsilon fragments were released by Sal I/EcoRV or EcoRI digestion, respectively, and purified over an Elutip filtration column (Schleicher & Schuell, Keene, NH) before microinjection.18

Transgenic mice.   Transgenic founders were generated according to a standard protocol by the University of Pennsylvania Transgenic and Chimeric Mouse Facility.18 Founder mice identified by Southern transfer analysis of tail DNA were mated with CD-1 females or C57BL6 males to generate F1 progeny with germline transgene integration. Generation and characterization of mice with targeted deletions of the endogenous alpha - and beta -globin genes are reported elsewhere.23-26 The genotypes of progeny with combinations of human transgenes and gene deletions were determined by Southern analysis and/or PCR analysis of tail DNA, and/or deduced from their globin phenotypes (detailed below).

Southern analysis.   Southern transfers were performed as previously described on 5 µg DNA purified from the tails of candidate mice.18 [32P]-random-primer labeled probes were generated from agarose gel-purified DNA templates. The hzeta transgene was identified as a 1.2-kb Pst I fragment using a 610-bp Nco I template encompassing the halpha -globin promoter region.18 The hepsilon transgene was identified as a 5.1-kb BamHI DNA fragment using a 572-bp BamHI/DraIII template encompassing the junction of the constituent beta -globin promoter and epsilon -globin transcribed regions. When necessary, a 1.3-kb BamHI fragment of intergenic DNA from the mouse (m) alpha -globin cluster (the `X' region) was identified using itself as template.18 Endogenous wild-type and alpha -globin knockout loci were identified as 13.0-kb and 9.0-kb HindIII DNA fragments, respectively, using a 1.3-kb BamHI fragment originating 5' to the tandem malpha -globin genes.23 hepsilon transgene copy numbers were estimated as described,18 based on two copies of epsilon -globin gene/human genome and two copies of `X' region/mouse genome.

PCR amplification.   Wild-type mbeta -globin genes were identified as a 250-bp PCR product by amplification of mouse tail DNA using an oligomer pair specific to exons I and II of the mouse beta Major-, beta Minor-, and beta Single-globin genes (5'CAACCCCAGAAACAGACATC3' and 5'CCAAGGGTAGACAACCAGC3'). The beta -globin knockout allele (containing an HPRT mini-gene)24 was identified as a 179-bp product with a sequence-specific oligomer pair (5'GACTGAACGTCTTGCTCGAG3' and 5'AGCTCTTCAGTCTGATAAAATC3'). Primers (100 pmol each) were added to 0.25 µg DNA in a 50-µL reaction assembled according to the manufacturer's recommendations (Perkin Elmer Cetus, Norwalk, CT) with MgCl2 adjusted to 2 mmol/L. Amplifications were performed for one cycle at 95°C × 3 minutes, 60°C × 15 seconds, and 72°C × 15 seconds, and for an additional 29 cycles using a modified (92°C × 1 minute) denaturation step. PCR products were analyzed on an EtBr-stained 5% polyacrylamide gel.

Globin analysis.   Five to 10 µL of phosphate-buffered saline (PBS)-washed transgenic erythrocytes were lysed in 4 vol 1 mmol/L MgCl2, and membranes pelleted at 4°C in a desktop centrifuge after addition of 1 vol 1.5 mol/L KCl. Globins were resolved by Triton-acid-urea gel electrophoresis in 5% acetic acid and visualized by Coomassie blue staining.27

Blood counts and peripheral blood smears.   Complete blood counts were performed on EDTA-anticoagulated blood from duplicate age- and sex-matched mice using a Cell-Dyne 3500 analyzer (Abbott Laboratories, Chicago, IL). Manually prepared peripheral blood smears were stained with Wright-Giemsa reagent and photographed under oil at 100× magnification through an Optifoto microscope (Nikon, New York, NY) using Ektachrome 160T film (Eastman Kodak, Rochester, NY).

    RESULTS
Abstract
Introduction
Methods
Results
Discussion
References

Generation of adult mice that express human embryonic globins.   Transgenes capable of expressing embryonic globins in adult erythrocytes were constructed by linking the transcribed regions of the human zeta - and epsilon -globin genes to transcriptional control elements from the human adult alpha - and beta -globin genes, respectively (Fig 1A and B). The zeta -globin transcribed region was linked to the alpha -globin promoter to generate the human zeta  (hzeta ) transgene,18 while the human epsilon  (hepsilon ) transgene was constructed by inserting the epsilon -globin transcribed region between the beta -globin promoter and 3' enhancer elements.20 Each chimeric gene was linked to core elements of hypersensitive sites 1-4 from the beta -globin locus control region (µbeta LCR) to promote integration site-independent expression.18,21 Multiple independent mouse lines containing the hzeta and hepsilon transgenes were generated using standard methods,18 and the transgene copy number for each line was established in F1 mice.18 The 5' cap and 3' poly(A) addition sites of the transcribed hepsilon - and hzeta -globin mRNAs were shown to be normally positioned using RNase protection analysis of RNA from adult reticulocytes (not shown). The expression of human embryonic globins was demonstrated by gel electrophoresis of clarified erythrocyte lysates (Fig 1C).27,28 Based on their high-level expression of hzeta - or hepsilon -globin, one hzeta -and one hepsilon -globin line, with transgene copy numbers of 14 and 7, respectively, were identified for use in all subsequent studies.


View larger version (22K):
[in this window]
[in a new window]
 
Fig 1. Generation of adult mice expressing human embryonic zeta - and &b.epsi;-globins. (A) Construction of the hzeta transgene. The full human zeta -globin transcribed region (black) was linked to the human alpha -globin gene promoter and 5' untranslated region (light).18 This chimeric hzeta transgene was subsequently linked to a µbeta LCR cassette containing core elements of DNase I hypersensitive sites 1-4.21 Exons are indicated as filled boxes, and translation initiation and termination codons by tick marks. (B) Construction of the h&b.epsi; transgene. The full-length &b.epsi;-globin transcribed region (black) is bracketed by the beta -globin promoter and 3' flanking region (light), including the 3' beta -globin enhancer element (E). Exons and translation initiation and termination sites are indicated as in (A). (C) Expression of embryonic globins in definitive erythrocytes from mice carrying the hzeta and h&b.epsi; transgenes. Clarified erythrocyte lysates from a wild type control (-), and hzeta and h&b.epsi; adult transgenic mice were resolved by Triton-acid-urea gel electrophoresis and visualized by Coomassie blue staining.27,28 Globin bands are identified to the right. The third lane (h&b.epsi;) was overloaded to demonstrate the h&b.epsi;-globin product.

Expression of embryonic hzeta -globin reverses an alpha -thalassemic phenotype.   Embryonic zeta -globin function in adult erythrocytes was initially assessed by determining its capacity to reverse an alpha -thalassemia phenotype. Transgenic mice expressing hzeta -globin were mated with mice heterozygous for combined deletion of the closely linked mouse alpha 2- and alpha 1-globin genes (malpha +/-; kind gift of J. Chang and Y.W. Kan, University of California, San Francisco).23 Globin genotypes of the offspring were determined by Southern analysis of tail DNA (Fig 2A), and phenotypes of compound hemizygous malpha +/-/hzeta mice were subsequently compared with those of sex-matched sibling malpha +/- controls. The size and shape of malpha +/- erythrocytes varied widely (Fig 2C), modeling the changes typically observed in human alpha -thalassemic erythrocytes.1-3 In contrast, erythrocytes from sex-matched malpha +/- littermates that coexpressed hzeta -globin were morphologically normal. The hypochromic, microcytic anemia of malpha +/- mice (low Hb [Hb], elevated erythrocyte number [RBC], small erythrocyte size [mean corpuscular volume or MCV], and depressed intracellular Hb [mean corpuscular Hb or MCH]) reverted to normal in malpha +/- mice that coexpressed hzeta -globin. (Fig 2E). The correction of the alpha -thalassemia phenotype in malpha +/- mice coexpressing hzeta -globin suggests that the embryonic globin assembles into Hb zeta 2beta 2 heterotetramers that are functional in adult erythrocytes.


View larger version (38K):
[in this window]
[in a new window]
 
Fig 2. Function of human embryonic zeta - and &b.epsi;-globins in adult murine erythrocytes. (A) Determination of mouse alpha -globin genotypes by Southern analysis. Duplicate Southern transfers of Pst I-digested DNA from wild-type mice (alpha +/+), mice carrying the hzeta transgene (alpha +/+/hzeta ), mice heterozygous for deletion of the malpha -globin genes (alpha +/-), and mice heterozygous for deletion of the malpha -globin genes that carried the hzeta transgene (alpha +/-/hzeta ). Blots were probed with a 1.3-kb fragment originating 5' to the deleted malpha -globin sequences (upper autoradiograph)23 or the halpha -globin promoter (lower autoradiograph).18 The sizes and identities of the wild-type (malpha +) and deleted malpha -globin loci (malpha -), and the hzeta transgene (hzeta ) are indicated to the left and right of each autoradiograph, respectively. (B) Determination of mouse beta -globin genotypes by combined Southern and PCR analyses. Tail DNA from mice was coamplified using paired oligomers recognizing wild-type mbeta -globin genes (250-bp product) or a fragment of the HPRT cDNA comprising the knockout `socket' (179-bp product).24 Reaction products were resolved and visualized on an ethidium bromide-stained 5% polyacrylamide gel. Genotypes are indicated at top. Southern analysis of the same DNA (bottom) using the 572-bp h&b.epsi; probe indicates the presence/absence of the h&b.epsi; transgene. The sizes and identities of the wild-type (mbeta +) and deleted mbeta -globin loci (mbeta -), and the h&b.epsi; transgene (h&b.epsi;) are indicated to the left and right of each autoradiograph, respectively. (C) Thalassemic erythrocyte morphology in malpha +/- mice is corrected by coexpression of embryonic zeta -globin. Wright-Giemsa-stained peripheral blood smears from wild-type, malpha +/-, and malpha +/-/hzeta mice, viewed under oil at 100 × magnification. A typical `target cell' is indicated (arrow). (D) Thalassemic erythrocyte morphology in mbeta +/- mice is corrected by coexpression of embryonic &b.epsi;-globin. Wright-Giemsa-stained peripheral blood smears from wild-type, mbeta +/-, and mbeta +/-/h&b.epsi; mice viewed under oil at 100 × magnification. (E) Resolution of anemia and normalization of erythrocyte indices in malpha +/- mice coexpressing embryonic zeta -globin. Erythrocyte analyses were performed on anticoagulated whole blood collected from duplicate sex-matched 13-week adult siblings. The Hb (open circle ), RBC number (square ), MCV (black-down-triangle ), and MCH (diamond ) are plotted for mice with the globin genotypes and sexes indicated at bottom. (F) Resolution of anemia and normalization of erythrocyte indices in mbeta +/- mice expressing embryonic &b.epsi;-globin. Analyses were performed on anticoagulated whole blood collected from duplicate sex-matched 9-week adult siblings as described in (E). The globin genotypes and sexes are indicated at bottom.

Expression of embryonic hepsilon -globin reverses a beta -thalassemic phenotype.   To assess the function of embryonic epsilon -globin in adult erythrocytes, transgenic hepsilon mice were mated with mice heterozygous for deletion of the two tandem endogenous adult beta -globin genes (mbeta +/- mice, kind gift of O. Smithies, University of North Carolina, Chapel Hill).24 The genotypes of offspring were determined by Southern and PCR analysis of tail DNA (Fig 2B). Both male and female mbeta +/- mice were growth retarded and displayed marked splenomegaly, characteristics shared by humans with severe forms of beta -thalassemia.1-3 Both of these phenotypic abnormalities resolved in mbeta +/- littermates coexpressing hepsilon -globin (data not shown). Moreover, mbeta +/- mice displayed severe erythrocyte morphologic changes comprising marked variation in erythrocyte size and shape, while erythrocytes from sex-matched mbeta +/- littermates coexpressing embryonic hepsilon -globin appeared normal (Fig 2D). Coexpression of the hepsilon -globin transgene also normalized Hb levels, RBC, MCV, and MCH in erythrocytes from mbeta +/- littermates (Fig 2F). The underlying functional abnormalities in mbeta +/- erythrocytes that result in their abnormal morphologies are thus corrected by expression of hepsilon -globin. These data imply that hepsilon -globin acts as a beta -like globin in adult erythrocytes by assembling into functional Hb alpha 2epsilon 2 heterotetramers.

Embryonic hzeta -globin rescues the viability of mice with homozygous lethal alpha -globin gene deletion.   The function of hzeta -globin in adult erythrocytes was more rigorously tested by inbreeding malpha +/-/hzeta mice to generate embryos that were homozygous for the malpha - deletion (malpha -/-). Although the expression of endogenous mzeta -globin permits normal embryonic development, mice with the malpha -/- genotype die in utero at the time of the embryonic zeta - to adult alpha -globin switch.25 Remarkably, however, these matings generated a number of malpha -/- mice whose viability was rescued by expression of embryonic hzeta -globin. These malpha -/-/hzeta mice, which do not synthesize any malpha -globin chains, appear identical to wild-type controls, are fertile, and bear normal litters (Fig 3A and C, and data not shown). The rescue of malpha -/- mice directly shows that embryonic hzeta -globin is a fully sufficient substitute for adult alpha -globin in definitive erythrocytes.

Embryonic hepsilon -globin rescues the viability of mice with homozygous lethal beta -globin gene deletion.   A similar strategy was used to determine whether human embryonic epsilon -globin could substitute for adult beta -globin in definitive erythrocytes. mbeta +/-/hepsilon mice were inbred, and genotypes of the weaned pups determined by analysis of genomic DNA (not shown). We failed to identify any mbeta -/- pups, consistent with previous reports that mice with homozygous deletion of the endogenous beta -globin genes (mbeta -/-) die in utero.26 Remarkably, though, the matings generated liveborn mbeta -/-/hepsilon mice that survived into adulthood, despite the complete absence of adult beta -globin in their erythrocytes (Fig 3B). Although viable mbeta -/-/hepsilon mice are smaller than nontransgenic controls (Fig 3D; see Discussion), their survival demonstrates the functional overlap between embryonic and adult beta -like globins.


View larger version (40K):
[in this window]
[in a new window]
 
Fig 3. Rescue of viability in mice homozygous for deletion of adult alpha - and beta -globin genes by expression of human embryonic zeta - and &b.epsi;-globin. (A) Globin profile of malpha -/-/hzeta mice. Clarified erythrocyte lysates prepared from mice with the indicated genotypes were resolved by Triton-acid-urea gel electrophoresis and visualized by Coomassie Blue staining. The identity of each globin band is indicated to the left of the gel. (B) Globin profile of mbeta -/-/h&b.epsi; mice. Clarified erythrocyte lysates were analyzed as described in (A). Genotypes are shown at the top, and globins identified to the left. (C) Physical appearance of malpha -/-/hzeta mice. Female malpha -/-/hzeta and control CD-1 mice are shown. (D) Physical appearance of mbeta -/-/h&b.epsi; mice. Male mbeta -/-/h&b.epsi; and control C57BL6 mice are shown.

    DISCUSSION
Abstract
Introduction
Methods
Results
Discussion
References

This report demonstrates that embryonic zeta - and epsilon -globins can functionally substitute for their adult alpha - and beta -globin homologues in adult erythroid cells. These findings suggest that individuals with alpha - or beta -thalassemia would likely benefit from reactivation of their endogenous embryonic zeta - or epsilon -globin genes, respectively. Moreover, the results bring into question the basis for the phylogenic conservation of globin gene switching.15,16,29

Transgenic mice are a valuable model system in which to study human embryonic globin function. The organization of the globin genes,1,30-32 molecular controls of their expression,1,33 and functions of their encoded globin proteins25,26 are closely conserved between mice and humans. Although mice do not exhibit a clearly defined fetal stage of beta -globin gene expression, they parallel human development by expressing different alpha -like and beta -like globins during intrauterine (embryonic/fetal) and extrauterine (adult) stages. The physiologic characteristics of Hb function and O2 transport in mice and humans are also quite similar. Previous reports have shown that deficiencies of alpha - or beta -globin chains in the mouse result in disorders that closely model human alpha - or beta -thalassemia, respectively (Fig 2), and that human alpha - and beta -globins can fully substitute for their mouse counterparts.25,26 These data indicate that the mouse model is an appropriate one in which to study human globin function.

To test the thesis that embryonic globins could sustain adult life, it was first necessary to overcome their tight developmental stage-specific regulation.1,9-11 Silencing of both zeta - and epsilon -globin genes at the embryonic-to-fetal transition appears to be mediated primarily through their transcriptional regulation,34-38 although recent evidence suggests that posttranscriptional events contribute to this process.18,39 Elements mapping to the 5' flanking region regulate transcriptional silencing of the epsilon -globin gene,34-36 while transcriptional silencing of the zeta -globin gene requires interaction of elements within both the 5' and 3' flanking regions.18,37,38 To maximize zeta - and epsilon -globin expression in adults, these regulatory elements were replaced by promoter and enhancer elements from the corresponding human adult globin genes (Fig 1A and B). By using this approach, and by linking each construct to a µbeta LCR before microinjection,18,21 it was possible to generate transgenes expressing high levels of embryonic globins in definitive mouse erythrocytes (Fig 1C).

The phenotypic severity of a thalassemic phenotype parallels the imbalance in alpha - and beta -globin chain expression in terminally differentiating erythroid cells. The excess globin chains---particularly free alpha -globin chains---exhibit cytotoxic effects that manifest clinically as inefficient erythropoiesis and chronic hemolytic anemia.1-3,5 Hence, the initial evidence that the embryonic hzeta - and hepsilon -globins could effectively substitute for deficient adult alpha - and beta -globins, respectively, was inferred from their ability to reverse the thalassemic phenotypes of malpha +/- and mbeta +/- mice. As in humans who are heterozygous for loss of both alpha -globin loci (alpha -thalassemia trait), malpha +/- mice grow normally despite a morphologically distinct hypochromic, microcytic anemia (Fig 2C and E).25 Heterozygosity for loss of beta -globin gene expression (mbeta +/-) in mice results in a slightly more severe phenotype, comprising growth retardation, splenomegaly, and marked erythrocyte abnormalities (Fig 2D and F, and data not shown),26 as also occurs in humans.1-3 Remarkably, the expression of embryonic hzeta -and hepsilon -globins reverses the growth retardation, anemia, and abnormal erythrocyte morphologies that characterize the thalassemic phenotypes in malpha +/- and mbeta +/- mice (Fig 2C through F, and data not shown). These results suggest that embryonic globins can substitute for their deficient adult counterparts, bringing the alpha :beta ratio back into balance.

The functional properties of embryonic zeta - and epsilon -globins were further tested by asking whether they were fully sufficient to replace their corresponding adult alpha - and beta -globins, respectively. As in humans,5 the alpha -/- genotype in mice is lethal in utero.25 Coexpression of embryonic hzeta -globin in malpha -/- mice results in viable adults which appear identical to age- and sex-matched wild-type controls (Fig 3A and C). The mbeta -/- genotype, which is also lethal to mice in utero,26 differs from its corresponding genetic disorder in humans, because human gamma -globin supports fetal growth and development through birth.1-3 Mice with homozygous lethal deletion of both beta -globin loci (mbeta -/-) were rescued by expression of embryonic hepsilon -globin (Fig 3B and D). Although these mbeta -/-/hepsilon mice were viable and fertile, they appear to be small relative to wild-type controls. This modest growth retardation may reflect a residual deficit in hepsilon -globin levels, although functional deficiencies cannot be excluded. Nonetheless, the data demonstrate that embryonic zeta - and epsilon -globins are remarkably effective substitutes for their adult alpha - and beta -globin counterparts. This implies assembly of functional Hb zeta 2beta 2 and alpha 2epsilon 2 heterotetramers that bind and discharge O2 in a manner that is physiologically valuable in adult erythrocytes.

The demonstration that expression of zeta - and epsilon -globins reverses the phenotypes in adult mice with deficient levels of alpha - and beta -globins indicates that clinically significant alpha - and beta -thalassemias in humans might be mitigated by reactivation of endogenous embryonic zeta - or epsilon -globin genes, respectively. The feasibility of this approach is demonstrated by the phenotypic reversion resulting from high-level gamma -globin expression in beta -thalassemics with concomitant HPFH mutations.12 Embryonic globin genes are structurally and functionally unaffected by the vast majority of alpha - and beta -thalassemic mutations, making them theoretically available for reactivation in most fetuses or adults with thalassemia. The current work shows that zeta -globin, encoded by the single extant nonadult alpha -like globin gene, has potential value to individuals with severe forms of alpha -thalassemia (Hb H disease), as well as to developing fetuses with otherwise lethal alpha -thalassemia hydrops fetalis.5 The parallel recognition that epsilon -globin can substitute for beta -globin in adults provides an alternate to the gamma -globin genes as a target for developing molecular therapies. The epsilon -globin gene may be particularly valuable in this regard, as its transcriptional control is gene-autonomous,40 in contrast with the fetal gamma -globin genes, whose expression may be affected by the structural integrity of the adjacent beta -globin gene.41-43 Theoretically, this functional linkage of gamma - and beta -globin gene expression might complicate attempts to fully reactivate gamma -globin gene expression in individuals with thalassemias resulting from nondeletional mutations of the beta -globin gene. In addition to its O2-transporting capacity, epsilon -globin may possess other properties, such as antipolymerization activity, which might benefit individuals with sickle cell disease or related hemoglobinopathies. These functional characteristics of human embryonic globins remain to be explored.

The current data bring into question the widely held model that the highly conserved process of globin gene switching in higher vertebrates reflects some crucial difference between the functions of embryonic and adult globins. The viability of malpha -/-/hzeta mice indicates that zeta -globin can subserve the spectrum of functions required of alpha -like globins in both embryonic and fetal/adult erythroid environments. The lack of a strong physiologic requirement for globin gene switching is further suggested by the recent demonstration that alpha -globin can also subserve both embryonic and adult/fetal functions in mice with homozygous inactivation of endogenous mzeta -globin expression.44 These observations would support previous claims that maintenance of a trans-placental O2 gradient may not be the major force underlying the evolutionary conservation of the zeta -to-alpha -globin switch.5,16 The phylogenic conservation of globin switching may instead reflect a marginal survival advantage due to mechanisms that have not yet been established. However, from the present data it is clear that reactivation of the embryonic genes in erythroid progenitors from alpha - or beta -thalassemic adults would result in a striking survival advantage.

    FOOTNOTES

   Submitted July 29, 1998; accepted August 20, 1998.
   Supported in part by Grants No. HL-K11-02623 (J.E.R.) and HL-38632 (S.A.L.). J.E.R. is the recipient of a research fellowship from the Cooley's Anemia Foundation; S.A.L. is an Investigator of the Howard Hughes Medical Institute.
   Address reprint requests to J. Eric Russell, MD, Abramson Research Bldg, Room 316F, Children's Hospital of Philadelphia, 34th St and Civic Center Blvd, Philadelphia, PA 19104; e-mail: jeruss{at}mail.med.upenn.edu.
   The publication costs of th