Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clément, M.-V.
Right arrow Articles by Pervaiz, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clément, M.-V.
Right arrow Articles by Pervaiz, S.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, Vol. 92 No. 3 (August 1), 1998: pp. 996-1002

Chemopreventive Agent Resveratrol, a Natural Product Derived From Grapes, Triggers CD95 Signaling-Dependent Apoptosis in Human Tumor Cells

By Marie-Véronique Clément, Jayshreekumari L. Hirpara, Sanaul-Haq Chawdhury, and Shazib Pervaiz

From the Department of Physiology and Oncology Research Institute, NUMI, National University of Singapore, Singapore.


    ABSTRACT
Abstract
Introduction
Methods
References

Resveratrol, a constituent of grapes and other food products, has been shown to prevent carcinogenesis in murine models. We report here that resveratrol induces apoptotic cell death in HL60 human leukemia cell line. Resveratrol-treated tumor cells exhibit a dose-dependent increase in externalization of inner membrane phosphatidylserine and in cellular content of subdiploid DNA, indicating loss of membrane phospholipid asymmetry and DNA fragmentation. Resveratrol-induced cell death is mediated by intracellular caspases as observed by the dose-dependent increase in proteolytic cleavage of caspase substrate poly (ADP-ribose) polymerase (PARP) and the ability of caspase inhibitors to block resveratrol cytotoxicity. We also show that resveratrol treatment enhances CD95L expression on HL60 cells, as well as T47D breast carcinoma cells, and that resveratrol-mediated cell death is specifically CD95-signaling dependent. On the contrary, resveratrol treatment of normal human peripheral blood lymphocytes (PBLs) does not affect cell survival for up to 72 hours, which correlates with the absence of a significant change in either CD95 or CD95L expression on treated PBLs. These data show specific involvement of the CD95-CD95L system in the anti-cancer activity of resveratrol and highlight the chemotherapeutic potential of this natural product, in addition to its recently reported chemopreventive activity.

© 1998 by The American Society of Hematology.

    INTRODUCTION
Abstract
Introduction
Methods
References

A NEWER DIMENSION in the management of neoplasia is the increasing awareness that chemoprevention, which refers to the administration of chemical agents to prevent the initiational and promotional events associated with carcinogenesis, could be the most direct way to reduce mortality and morbidity. In the search for new cancer chemopreventive agents over the past few years, hundreds of plant extracts have been evaluated. Resveratrol, a phytoalexin found in grapes, fruits, and root extracts of the weed Polygonum cuspidatum, has been an important constituent of Japanese and Chinese folk medicine.1-3 Indirect evidence suggests that the presence of resveratrol in white and rose wine may explain for the reduced risk of coronary heart disease associated with moderate wine consumption.4,5 This effect has been attributed to the inhibition of platelet aggregation and coagulation, in addition to the antioxidant and anti-inflammatory activity of resveratrol.6,7 Moreover, a recent report shows that resveratrol is a potent cancer chemopreventive agent in assays representing three major stages of carcinogenesis.8 Whereas the ability to inhibit cellular events associated with tumor initiation, promotion, and progression has been attributed to the anticyclooxygenase activity (COX-1) of resveratrol, the precise mechanism of antitumor activity is not well understood.

We report here the results of our findings showing that resveratrol induces apoptotic cell death in HL60 leukemia cells as well as in T47D breast carcinoma cells at doses minimally toxic to normal peripheral blood lymphocytes (PBLs). Resveratrol-induced apoptosis is mediated via caspase activation inhibitable by tetrapeptide caspase inhibitors DEVD-CHO or YVAD-CHO. Furthermore, resveratrol enhances CD95L expression and induces CD95 signaling-dependent cell death in both tumor cell lines.

    MATERIALS AND METHODS
Abstract
Introduction
Methods
References

Chemicals.   Resveratrol, propidium iodide (PI), MTT, crystal violet, and RNAse A were obtained from Sigma Chemical Co (St Louis, MO). Annexin-fluorescein isothiocyanate (FITC), YVAD-CHO, and DEVD-CHO were purchased from Clontech Laboratories, Inc (Palo Alto, CA). Anti-PARP monoclonal antibody (C-2-10) was obtained from Biomol Research Laboratories, Inc (Plymouth Meeting, PA), anti-CD95 (ZB4) was from Upstate Biotechnology Inc (Lake Placid, NY), anti-CD95L (NOK-1) and isotype control mouse IgG1kappa were purchased from Pharmingen (San Diego, CA). Stock solution of resveratrol was made in dimethylsulfoxide (DMSO) at a concentration of 100 mmol/L. Working dilutions were directly made in the tissue culture medium.

Cytotoxicity assays.   Human promyelocytic leukemia cell line HL60 and human breast carcinoma cell line T47D were obtained from ATCC (Rockville, MD) and maintained in culture in RPMI 1640 supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT) in an atmosphere of 5% CO2 at 37°C. Normal human PBLs were obtained from blood donated by healthy volunteers by ficoll hypaque density centrifugation. For HL60 cells and normal PBLs, 1 × 105 cells/well in a 96-well plate were exposed to increasing concentrations of resveratrol (4 µmol/L to 32 µmol/L) for 24 to 48 hours (HL60) or for 24 to 72 hours (PBLs). T47D cells were plated in 96-well plates (2 × 104/well) 24 hours before the addition of resveratrol. Medium was then aspirated and replaced with fresh RPMI 1640 + 10% FBS containing resveratrol for 24 hours. Equal concentration of the vehicle carrier (DMSO) was always present in the control wells. For blocking experiments, tumor cells were preincubated for 1 hour with anti-CD95 (1 µg/mL) or anti- CD95L (1 µg/mL), and in a separate set of experiments with 2.5 µmol/L DEVD-CHO or YVAD-CHO alone or DEVD+YVAD (2.5 µmol/L each) before the addition of 32 µmol/L resveratrol. Mouse IgG1kappa was used as isotype control for antibody-blocking experiments. Viability was determined by the MTT assay for HL60 cells and for PBLs, or by the crystal violet assay for T47D cells. For MTT assay, 10 µL of 5 mg/mL of MTT was added to each well and incubated for 4 hours at 37°C. Elution of the precipitate was performed with 200 µL of DMSO + 10 µL of Tris-glycine buffer (0.1 mol/L Tris, 0.1 mol/L Glycine, pH 10.5, with 1N NaOH). Cell viability was calculated from absorption values obtained at 570 nm using an automated enzyme-linked immunosorbent assay (ELISA) reader. For crystal violet assays, medium was aspirated and replaced for 10 minutes with 50 µL of 0.75% crystal violet in 50% ethanol, 0.25% NaCl, and 1.75% formaldehyde solution. Cells were then washed with water, air-dried, and the dye eluted with PBS + 1% sodium dodecyl sulfate (SDS) solution. Cell viability was assessed by dye absorbance measured at 595 nm on an automated ELISA reader.

Phosphatidylserine (PS) translocation and DNA content analyses.   Externalization of inner membrane PS was assessed by the ApoAlert-Annexin V Apoptosis Kit (Clontech) according to the recommended protocol and analyzed by flow cytometry with Coulter Epics Elite ESP flow cytometer (Coulter Corporation, Miami, FL) equipped with a single argon ion laser with the excitation wavelength at 488 nm and the emission set at 525 nm (green). For cellular DNA content determination, 1 × 106 cells/mL were treated with resveratrol as above. Sample preparation and staining with PI for DNA content was performed as described elsewhere.9 Stained cells were analyzed by flow cytometry with the excitation set at 488 nm and emission at 610 nm (red). At least 10,000 events were analyzed.

Determination of caspase activation.   We analyzed caspase-specific cleavage of poly (ADP-ribose) polymerase (PARP) in lysates of tumor cells treated with resveratrol. Lysates of HL60 cells (2 × 106) were prepared in sample buffer (62.5 mmol/L Tris/HCl, pH 6.8; 6 mol/L urea; 10% glycerol; 2% SDS; 0.00125% bromophenol blue; 5% beta -mercaptoethanol) following overnight exposure to resveratrol (8 to 32 µmol/L). Following 10% polyacrylamide gel electrophoresis (PAGE) and transfer to nitro-cellulose, membranes were blocked overnight with 5% dry milk in Tris buffered saline containing Tween 20 (TBST) (50 mmol/L Tris/HCl, pH 7.4; 150 mmol/L NaCl; 0.1% Tween 20). Blocked membranes were exposed to anti-PARP antibody (1:10,000 dilution) for 2 hours at room temperature, washed 3 times with TBST, and incubated with 1:10,000 dilution of anti-mouse IgG-HRP conjugate supplied as 0.8 mg/mL (Pierce, Rockford, IL) for 1 hour and washed 3 times with TBST. Chemiluminescence was detected using the SuperSignal Substrate Western Blotting Kit (Pierce).

Immunofluorescence for CD95 and CD95L.   Immunofluorescence staining for CD95 and CD95L was performed as described elsewhere.10 Briefly, HL60, T47D cells, and normal human PBLs (1 × 106) were treated with resveratrol (32 µmol/L), washed twice with phosphate-buffered saline (PBS) + 1% FBS, and fixed in 1 mL of 4% paraformaldehyde for 15 minutes on ice. After a wash with PBS, cells were permeablized in ethanol for 1 hour on ice, washed with PBS, and incubated with 1 µg of anti-CD95 or anti-CD95L for 30 minutes on ice. Following another wash with PBS + 1% FBS, samples were exposed to FITC-conjugated goat anti-mouse IgG for 30 minutes, washed, and resuspended in 0.5 mL of 2% paraformaldehyde. Mouse IgG1kappa was used as isotype control. Viable cells were gated on forward side scatter analysis, and a total of 10,000 events were analyzed by flow cytometry using an emission wavelength of 525 nm.

Reverse transcription polymerase chain reaction (RT-PCR) for CD95L expression.   Total RNA was extracted from HL60 cells (10 × 106) following incubation with 32 µmol/L resveratrol for 0, 4, 8, and 20 hours using TRIZOL reagent (GIBCO-BRL, Gaithesburg, MD) according to the manufacturer's recommendations. First-strand cDNA synthesis was performed with 5 µg of each RNA using oligo dT primers. Two hundred units of Superscript reverse transcriptase (GIBCO-BRL) were used per reaction (total volume 20 µL), and incubation was performed at 42°C for 50 minutes followed by denaturation at 70°C for 10 minutes. PCR amplification was then performed using 3 µL of the reversed transcribed cDNA using CD95L-specific primers (sense: 5'ATGCAGCAGCCCTTCAAT and antisense: 5'CTTCACTCCACAAAGCAGGAC) generating a product of 524 bp. PCR was performed using a thermocycler (M J Research Inc, Watertown, MA) with Ready to Go PCR beads (Pharmacia Biotech, Uppsala, Sweden). An initial step of 94°C for 2 minutes was followed by 34 cycles of 94°C for 30 seconds, 56°C for 45 seconds, and 68°C for 1 minute. A final extension step at 68°C for 8 minutes was then performed and the product was visualized on a 1.5% agarose gel. beta -actin amplification using the same cDNAs and PCR conditions was performed using primers (sense: 5'ATGGATGATGATATCGCCGCG and antisense: 5'CTAGAAGCATTTGCGGTGGAC) as a control.

    RESULTS AND DISCUSSION

Resveratrol induces caspase-mediated apoptosis in HL60 cells.   HL60 cells were exposed to increasing concentrations (4 to 32 µmol/L) of commercially available resveratrol (trans resveratrol) for 24 to 48 hours. Our results show a dose-dependent increase in tumor cell mortality with greater than 80% cell death by 48 hours (Fig 1). To investigate the mode of cell death induced by resveratrol, we studied three hallmarks of apoptotic commitment, ie, DNA subdiploidy, change in membrane phospholipid asymmetry, and intracellular caspase activation. Analysis of DNA content following resveratrol treatment of HL60 cells indicates an increase in the subdiploid DNA content as shown by the sub-G1 population on cell cycle analysis (Fig 2). This fraction is representative of cells with decreased staining for PI and is an indicator of DNA fragmentation associated with apoptotic cell death.11 Our data also show that HL60 cells treated for 18 hours with 32 µmol/L resveratrol exhibit increase in cell surface expression of inner membrane PS (Fig 2), indicating loss of phospholipid asymmetry. PS externalization is another marker associated with onset of apoptotic cell death in response to a variety of stimuli.12-14 Finally, we investigated the role of intracellular caspases,15 homologs of the Caenorhabditis elegans apoptotic inducer CED-3 family16 in apoptotic cell death induced by resveratrol. Apoptotic cells exhibit increased caspase activity detected by cleavage of caspase-specific substrate PARP that occurs at the onset of apoptosis.17-19 Our results indicate a dose-dependent increase in the cleaved PARP fragment (85 kD) upon Western analysis of lysates from resveratrol-treated HL60 cells indicating caspase activation (Fig 3A). Furthermore, we show that resveratrol cytotoxicity is significantly inhibited in the presence of either tetrapeptide inhibitor of caspase-3 (DEVD-CHO) or caspase-1 and caspase-1-like proteases (YVAD-CHO), and complete rescue of the cells is obtained when both inhibitors are added together (Fig 3B). These data clearly highlight the role of caspase activation in resveratrol-induced cell death. Taken together, our first set of experiments show that leukemia cells treated with resveratrol exhibit morphological and biochemical hallmarks of apoptotic cell death.


View larger version (11K):
[in this window]
[in a new window]
 
Fig 1. Sensitivity of HL60 cells to resveratrol. HL60 cells were treated with increasing concentrations of resveratrol for 24 and 48 hours, and viability was determined by the MTT assay as described in Materials and Methods. Data shown are representative of at least three independent experiments.


View larger version (14K):
[in this window]
[in a new window]
 
Fig 2. Resveratrol induces DNA fragmentation and loss of membrane phospholipid asymmetry. (A) Flow cytometry analysis of DNA cleavage in resveratrol-treated tumor cells. HL60 cells were treated with 32 µmol/L resveratrol for 18 hours, immediately fixed in ethanol, and stained with PI for DNA content analysis as described in Materials and Methods. Sub-G1 population indicates subdiploid DNA content indicative of apoptotic DNA fragmentation. Data shown are representative of at least three independent experiments. (B) Externalization of membrane PS induced by resveratrol in HL60 cells. 1 × 106 cells were treated with resveratrol for 18 hours, and PS translocation was assessed by staining tumor cells with Annexin V-FITC (1 µg/mL) conjugate. A total of 10,000 events were analyzed by flow cytometry.


View larger version (31K):
[in this window]
[in a new window]
 
Fig 3. Caspase-mediated apoptotic cell death induced by resveratrol (A) SDS-PAGE analysis of caspase-specific PARP cleavage in lysates of resveratrol-treated HL60 cells. Tumor cells (2 × 106) were treated with resveratrol (8 to 32 µmol/L) for 24 hours, lysed, subjected to 10% SDS-PAGE, and transferred to nitro-cellulose membranes as described in Materials and Methods. PARP cleavage was detected using a primary monoclonal antibody C-2-10 followed by the secondary HRP-conjugated anti-mouse IgG. Arrows indicate the intact protein of 116 kD and the proteolytic cleaved fragment (85 kD). (B) Inhibition of apoptotic cell death in HL60 cells treated with 32 µmol/L resveratrol for 24 hours in the presence of 2.5 µmol/L caspase inhibitors DEVD-CHO or YVAD-CHO or both. Cytotoxicity was determined by the MTT assay, and data shown are mean ±SD of three independent experiments.

Resveratrol enhances CD95L and induces CD95 signaling-dependent apoptosis in HL60 and T47D cells.   Recent observations have highlighted the role of CD95-CD95L system in chemotherapy-induced apoptosis of tumor cells via upregulation of the CD95 receptor or its ligand CD95L.20-22 Given the fact that HL60 leukemia cells, like many other leukemia cell lines,23 express the CD95 receptor, we hypothesized that resveratrol-induced HL60 cell death may also involve the CD95-CD95L system. Indeed, our results show that enhanced CD95L expression is detectable within 12 hours of treatment with resveratrol and is significantly increased at 24 hours following drug exposure (Fig 4). These findings are corroborated by increased expression of CD95L mRNA following exposure to resveratrol (4 to 20 hours), as shown in Fig 4B. On the contrary, CD95 expression is not significantly changed at 12 hours; however, by 24 hours the cells surviving resveratrol cytotoxicity have a CD95low phenotype, suggesting that resveratrol-induced cell death preferentially targets CD95high-expressing cells. Moreover, a comparison of resveratrol-induced CD95L upregulation and cell cytotoxicity reveals that cell death measured by cell cytotoxicity assays coincides with increased expression of CD95L as shown in Fig 4. The specific involvement of CD95-CD95L system in HL60 cell death induced by resveratrol is further supported by significant inhibition of cell death in the presence of either anti-CD95 or anti-CD95L, whereas isotype control antibody has little effect on cell death as shown in Fig 5.


View larger version (26K):
[in this window]
[in a new window]
 


View larger version (22K):
[in this window]
[in a new window]
 
Fig 4. CD95 and CD95L expression following resveratrol treatment of HL60 cells. (A) HL60 cells were treated with 32 µmol/L resveratrol, and surface expression of CD95 and CD95L was analyzed by flow cytometry at 6 hours, 12 hours, and 24 hours as described in Materials and Methods. The shaded histograms are for mouse IgG1kappa used as an isotype control, the dotted lines represent nontreated HL60 cells, and the solid lines indicate resveratrol-treated HL60 cells. At least 10,000 events were counted, and data shown are representative of at least three separate experiments. (B) RT-PCR amplification of CD95L and beta -actin mRNA following treatment of HL60 cells with 32 µmol/L resveratrol for 0, 4, 8, and 20 hours.


View larger version (38K):
[in this window]
[in a new window]
 
Fig 5. Resveratrol-induced tumor cell death is dependent on CD95-CD95L interaction. HL60 cells were preincubated for 1 hour with either anti-CD95 (1 µg/mL) or anti-CD95L (1 µg/mL) before the addition of 32 µmol/L resveratrol. Cell viability was determined following 24 hours incubation by the MTT assay, and data shown are mean ±SD of three independent experiments.

To ascertain if resveratrol-mediated CD95-dependent apoptosis was a general phenomenon or if it was exclusive for leukemia cells, we investigated the effect of resveratrol on a solid tumor model, ie, T47D breast carcinoma cell line. Similar to HL60 cells, T47D cells constitutively express the CD95 receptor but not the CD95L. However, our data show that following 18 hours of exposure to resveratrol there is a significant increase in cell surface expression of CD95L, whereas CD95 expression essentially remains unchanged (Fig 6A). Concomitantly, 37% of resveratrol-treated (32 µmol/L) T47D cells undergo cell death, which is completely inhibited in the presence of anti-CD95 antibody (Fig 6B). These data show that CD95-signaling-dependent apoptosis triggered by resveratrol is not exclusive for human leukemia cells and further highlight the specific involvement of the CD95-CD95L system in tumor cell death induced by resveratrol.


View larger version (25K):
[in this window]
[in a new window]
 
Fig 6. Resveratrol enhances CD95L expression and induces CD95 signaling-dependent cell death in T47D cells. (A) T47D cells were treated with 32 µmol/L resveratrol for 18 hours, and surface expression of CD95 and CD95L was analyzed by flow cytometry as described in Materials and Methods. The shaded histograms are for mouse IgG1kappa used as an isotype control, the dotted lines represent nontreated T47D cells, and the solid lines indicate resveratrol-treated T47D cells. At least 10,000 events were counted, and data shown are representative of at least three separate experiments. (B) T47D cells were treated for 24 hours with 32 µmol/L resveratrol alone (medium) or in the presence of 1 µg/mL of anti-CD95 (anti-CD95) or IgG1kappa (isotype Ig) antibody. Cell viability was determined by the crystal violet assay, and data shown are mean ±SD of three independent experiments.

Resveratrol does not affect survival of normal human PBLs.   Triggered by our findings on the antitumor activity of resveratrol, we next investigated the effect of resveratrol treatment on normal human PBLs. Our data show that resveratrol has minimal toxicity to normal human PBLs for up to 72 hours as shown in Fig 7A. Moreover, normal human PBLs that express basal levels of CD9524 and CD95L25 do not significantly undergo change in surface expression of either CD95 or CD95L following resveratrol exposure for up to 72 hours (Fig 7B). In a separate set of experiments, PBLs were activated with phytohemaglutinin (PHA) in the presence or absence of resveratrol (up to 32 µmol/L) for 72 hours. No acceleration of activation-induced cell death was observed as compared with PHA-activated cells alone (data not shown). The inability of resveratrol to induce cell death in normal human PBLs, unlike HL60 and T47D cells, could then be explained by the failure of resveratrol to upregulate CD95L, thereby preventing CD95-CD95L interaction in normal PBLs. These results show that resveratrol-induced cell death is tumor specific and further support the involvement of CD95-CD95L system as the apoptotic trigger.


View larger version (10K):
[in this window]
[in a new window]
 


View larger version (26K):
[in this window]
[in a new window]
 
Fig 7. Effect of resveratrol on normal human PBL survival and cell surface expression of CD95 and CD95L. (A) Normal human PBLs were treated with resveratrol (8 to 32 µmol/L) for 24 and 72 hours as described in Materials and Methods. Cell viability was determined by the MTT assay and represents three independent observations. (B) Flow cytometry analysis of CD95 and CD95L expression on normal human PBLs was performed as for HL60 cells, except that PBLs were analyzed for 12, 24, and 72 hours. The shaded histograms are for mouse IgG1kappa used as an isotype control, the dotted lines represent nontreated PBLs, and the solid lines indicate resveratrol-treated PBLs. At least 10,000 events were counted, and data shown are representative of at least three separate experiments.

The selective targeting of human tumor cell lines by resveratrol is extremely interesting, especially in the context of a recent report on the chemopreventive activity of this natural product in murine models of skin tumors.8 Our findings suggest a basis for the observed inhibition of tumor formation in these animals. The chemopreventive activity of resveratrol could be explained by the induction of CD95-dependent apoptotic cell death in tumor cells, resulting in inhibition of tumor initiation and progression. Several recent communications have highlighted the role of the CD95-CD95L system in drug-induced or immune-mediated clearance of tumor cells,20-23,26,27 suggesting that the fate of antitumor therapy might be determined by the balance between CD95 and CD95L expression on tumor cells and on immune cells. Once triggered, the CD95 receptor can then activate a series of intracellular events culminating in the death cascade composed of intracellular caspases.28,29 These observations have led to the suggestion that autocrine and/or paracrine CD95/CD95L-mediated signaling might be one critical event in drug-induced tumor cell death. Our observations show that resveratrol treatment provides the critical level of expression of the CD95-CD95L system on tumor cells sufficient to trigger intracellular apoptotic cascade. In addition, the inability of resveratrol to induce CD95-mediated cell death in normal PBLs further supports the specific involvement of the CD95-CD95L system in resveratrol-induced tumor cell death. Resveratrol-induced enhancement of CD95L on CD95+ tumor cells constitutes an effective system for the induction of tumor suicide without nonspecific toxicity to the normal PBLs. However, to extrapolate our in vitro findings to in vivo chemoprevention, more studies need to be performed to determine the stability, half-life, and biologically significant concentrations of resveratrol needed to activate the apoptotic pathway in vivo. Nevertheless, these data provide evidence that this natural chemopreventive agent, not known for its chemotherapeutic potential, also fulfils two basic criteria for an effective therapeutic agent, ie, tumor specificity and minimal toxicity to the normal hematopoietic cells. Taken together, our findings strongly suggest that resveratrol merits further investigation as a cancer chemopreventive as well as a chemotherapeutic agent in humans.

    FOOTNOTES

  
   Supported by Grant No. 970333 from the National University of Singapore.
   Address reprint requests to Shazib Pervaiz, MD, PhD, Department of Physiology, Faculty of Medicine, National University of Singapore, 10 Kent Ridge Crescent, Singapore 119260.
   The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.

    ACKNOWLEDGMENT

The authors acknowledge the technical assistance of Christopher Loh, Bee Ling Ng, and Kameedea Appleton.

    REFERENCES
Abstract
Introduction
Methods
References

1. Nonomura S, Kanagawa H, Makimoto A: Chemical constituents of polygonaceous plants. I. Studies on the components of K0-jo-kon. (Polygonum cuspidatum SIEB et ZUCC). Yakugaku Zasshi 83:988, 1963

2. Kubo M, Kimura Y, Shin H, Haneda T, Tani T, Namba K: Studies on the antifungal substance of crude drug (II). On the roots of Polygonum cupsidatum Sieb et Zucc (Polygonaceae). Shoyakugaku Zashi 35:58, 1981

3. Soleas GJ, Diamandis EP, Goldberg DM: Resveratrol: A molecule whose time has come? and gone? Clin Biochem 30:91, 1997[Medline] [Order article via Infotrieve]

4. Rimm EB, Klatsky A, Grobbee D, Stampfer MJ: Review of moderate alcohol consumption and reduced risk of coronary heart disease: Is the effect due to beer, wine, or spirits? Br Med J 312:731, 1996[Abstract/Free Full Text]

5. Gaziano JM, Buring JE, Breslow JL, Goldhaber SZ, Rosner B, Van Denburgh M, Willett W, Hennekens CH: Moderate alcohol intake, increased levels of low density lipoprotein and its subfractions and decreased risk of myocardial infarction. N Engl J Med 329:1829, 1993[Abstract/Free Full Text]

6. Pace-Asciak CR, Hahn S, Diamandis EP, Soleas G, Goldberg DM: The red wine phenolics trans resveratrol and quercetin block human platelet aggregation and eicosanoid synthesis: Implications for protection against coronary heart disease. Clin Chim Acta 235:207, 1995[Medline] [Order article via Infotrieve]

7. Frankel EN, Waterhouse AL, Kinsella JE: Inhibition of human LDL oxidation by reveratrol. Lancet 341:1103, 1993[Medline] [Order article via Infotrieve]

8. Jang M, Cai L, Udeani GO, Slowing KV, Thomas CF, Beecher CW, Fong HH, Farnsworth NR, Kinghorn AD, Mehta RG, Moon RC, Pezzuto JM: Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275:218, 1997[Abstract/Free Full Text]

9. O'Brien MC, Healy SF Jr, Raney SR, Hurst JM, Avner B, Hanly A, Mies C, Freeman JW, Snow C, Koester SK, Bolton WE: Discrimination of late apoptotic/necrotic cells (type III) by flow cytometry in solid tumors. Cytometry 28:81, 1997[Medline] [Order article via Infotrieve]

10. Villunger A, Egle A, Kos M, Hartmann BL, Geley S, Kofler R, Greil R: Drug-induced apoptosis is associated with enhanced Fas(Apo-1/CD95) ligand expression but occurs independently of Fas(Apo-1/CD95) signaling in human T-acute lymphatic leukemia cells. Cancer Res 57:3331, 1997[Abstract/Free Full Text]

11. Kaufman SH: Induction of endonucleolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptotecin, and other cytotoxic anticancer drugs: Cautionary note. Cancer Res 49:5870, 1989[Abstract/Free Full Text]

12. Connor J, Pak CC, Schroit AJ: Exposure of phosphatidylserine in the outer leaflet of human red cells. Relationship to cell density, cell age, and clearance by mononuclear cells. J Biol Chem 28:2399, 1994

13. Martin SJ, Reutelingsperger CPM, McGahon AJ, Rader J, van Schie RCAA, LaFace DM, Green DR: Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus. Inhibition by overexpression of Bcl-2 and Abl. J Exp Med 182:1545, 1995[Abstract/Free Full Text]

14. Fadok VA, Voelker DR, Campbell PA, Cohen JJ, Bratton DL, Henson PM: Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers recognition and removal by macrophages. J Immunol 148:2207, 1992[Abstract]

15. Alnemri ES, Livingston DJ, Nicholson DW, Salvesen G, Thornberry NA, Wong WW, Yuian J: Human ICE/CED-3 protease nomenclature. Cell 87:171, 1996[Medline] [Order article via Infotrieve]

16. Yuan J, Shaham S, Ledoux S, Ellis HM, Horvitz HR: The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin 1b converting enzyme. Cell 75:641, 1993[Medline] [Order article via Infotrieve]

17. Miura M, Zhu H, Rotello R, Hartwieg EA, Yuan J: Induction of apoptosis in fibroblasts by interleukin1b-converting enzyme, a mamalian homolog of the C. elegans cell death gene ced-3. Cell 75:653, 1993[Medline] [Order article via Infotrieve]

18. Lazebnick YA, Kaufman SH, Desnoyers S, Poirier GG, Earnshaw WC: Cleavage of poly (ADP-ribose) polymerase by the proteinase with properties like ICE. Nature 371:346, 1994[Medline] [Order article via Infotrieve]

19. Kaufman SH, Desnoyers S, Ottaviano Y, Davidson NE, Poirier GG: Specific proteolytic cleavage of poly (ADP-ribose) polymerase: An early marker of chemotherapy-induced apoptosis. Cancer Res 53:3976, 1993[Abstract/Free Full Text]

20. Friesen C, Herr I, Krammer PH, Debatin K-M: Involvement of the CD95 (APO-1/Fas) receptor/ligand system in drug-induced apoptosis in leukemia cells. Nat Med 2:574, 1996[Medline] [Order article via Infotrieve]

21. Muller M, Strand S, Hug H, Heinemann E-M, Walczak H, Hofmann WJ, Stremmel W, Krammer PH, Galle PR: Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild type p53. J Clin Invest 99:403, 1997[Medline] [Order article via Infotrieve]

22. Fulda S, Sieverts H, Friesen C, Herr I, Debatin KM: The CD95 (APO-1/Fas) system mediates drug-induced apoptosis in neuroblastoma cells. Cancer Res 57:3823, 1997[Abstract/Free Full Text]

23. Micheau O, Solary E, Hammann A, Martin F, Dimanche-Boitrel M-T: Sensitization of cancer cells treated with cytotoxic drugs to fas-mediated cytotoxicity. J Natl Cancer Inst 89:783, 1997[Abstract/Free Full Text]

24. Miyawaki T, Uehara T, Nibu R, Tsuji T, Yachie A, Yonehara S, Taniguchi N: Differential expression of apoptosis-related Fas antigen on lymphocyte subpopulations in human peripheral blood. J Immunol 149:3753, 1992[Abstract]

25. Suda T, Takahashi T, Goldstein P, Nagata S: Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell 75:1169, 1993[Medline] [Order article via Infotrieve]

26. Trauth BC, Klas C, Peters AJM, Matzku S, Moller P, Falk W, Debatin KM, Krammer PH: Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245:301, 1989[Abstract/Free Full Text]

27. Rensing-Ehl A, Frei K, Flury R, Matiba B, Mariani SM, Weller M, Aebischer P, Krammer PH, Fontana A: Local Fas/Apo-1 (CD95) ligand-mediated tumor cell killing in vivo. Eur J Immunol 25:2253, 1995[Medline] [Order article via Infotrieve]

28. Muzio M, Chinnaiyan AM, Kischkel FC, O'Rouke K, Shevchenko A, Ni J, Scaffidi C, Bretz JD, Zhang M, Gentz R, Mann M, Krammer HP, Peter ME, Dixit V: FLICE, a novel FADD-homologous to ICE/CED-3-like protease, is recruited to the CD95(Fas/Apo-1) death-inducing signaling complex. Cell 85:817, 1996[Medline] [Order article via Infotrieve]

29. Kuida K, Lippke JA, Ku G, Harding MW, Livingston DJ, Su MS, Flavell RA: Altered cytokine export and apoptosis in mice deficient in interleukin 1b converting enzyme. Science 267:2000, 1995[Abstract/Free Full Text]


© 1998 by the American Society of Hematology.
 
0006-4971/98/92-0022$3.00/0

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
H. S. Byun, J. K. Song, Y.-R. Kim, L. Piao, M. Won, K. A. Park, B. L. Choi, H. Lee, J. H. Hong, J. Park, et al.
Caspase-8 has an essential role in resveratrol-induced apoptosis of rheumatoid fibroblast-like synoviocytes
Rheumatology, March 1, 2008; 47(3): 301 - 308.
[Abstract] [Full Text] [PDF]


Home page
Evid Based Complement Alternat MedHome page
N. Bianchi, C. Zuccato, I. Lampronti, M. Borgatti, and R. Gambari
Fetal Hemoglobin Inducers from the Natural World: A Novel Approach for Identification of Drugs for the Treatment of -Thalassemia and Sickle-Cell Anemia
Evid. Based Complement. Altern. Med., December 11, 2007; (2007) nem139v1.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
E.-O. Lee, H.-J. Lee, H.-S. Hwang, K.-S. Ahn, C. Chae, K.-S. Kang, J. Lu, and S.-H. Kim
Potent inhibition of Lewis lung cancer growth by heyneanol A from the roots of Vitis amurensis through apoptotic and anti-angiogenic activities
Carcinogenesis, October 1, 2006; 27(10): 2059 - 2069.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
A. KASDALLAH-GRISSA, B. MORNAGUI, E. AOUANI, M. HAMMAMI, N. GHARBI, A. KAMOUN, and S. EL-FAZAA
PROTECTIVE EFFECT OF RESVERATROL ON ETHANOL-INDUCED LIPID PEROXIDATION IN RATS
Alcohol Alcohol., May 1, 2006; 41(3): 236 - 239.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. Sengottuvelan, P. Viswanathan, and N. Nalini
Chemopreventive effect of trans-resveratrol - a phytoalexin against colonic aberrant crypt foci and cell proliferation in 1,2-dimethylhydrazine induced colon carcinogenesis
Carcinogenesis, May 1, 2006; 27(5): 1038 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
Y.-J. Chun, S.-K. Lee, and M. Y. Kim
MODULATION OF HUMAN CYTOCHROME P450 1B1 EXPRESSION BY 2,4,3',5'-TETRAMETHOXYSTILBENE
Drug Metab. Dispos., December 1, 2005; 33(12): 1771 - 1776.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. Boissy, T. L. Andersen, B. M. Abdallah, M. Kassem, T. Plesner, and J.-M. Delaisse
Resveratrol Inhibits Myeloma Cell Growth, Prevents Osteoclast Formation, and Promotes Osteoblast Differentiation
Cancer Res., November 1, 2005; 65(21): 9943 - 9952.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Vyas, Y. Asmerom, and D. D. De Leon
Resveratrol Regulates Insulin-Like Growth Factor-II in Breast Cancer Cells
Endocrinology, October 1, 2005; 146(10): 4224 - 4233.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. B. Jones, S. E. DePrimo, M. L. Whitfield, and J. D. Brooks
Resveratrol-Induced Gene Expression Profiles in Human Prostate Cancer Cells
Cancer Epidemiol. Biomarkers Prev., March 1, 2005; 14(3): 596 - 604.
[Abstract] [Full Text] [PDF]

<

Home page