|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 92 No. 1 (July 1), 1998:
pp. 175-183
Naturally Occurring Mutations in Glycoprotein Ib That Result in
Defective Ligand Binding and Synthesis of a Truncated Protein
By
Dermot Kenny,
Ólafur G. Jónsson,
Patricia A. Morateck, and
Robert R. Montgomery
From the Departments of Medicine, Pediatrics, and Pathology, Medical
College of Wisconsin, Milwaukee; The Blood Research Institute, the
Blood Center of Southeastern Wisconsin, Milwaukee; and the Department
of Pediatrics, Reykjavík Hospital, Iceland.
 |
ABSTRACT |
The platelet GPIb-V-IX complex is the receptor for the initial
binding of von Willebrand factor (vWF) mediating platelet adhesion. The
complex is composed of four membrane-spanning glycoproteins (GP):
GPIb , GPIb , GPIX, and GPV. Bernard-Soulier syndrome results from
a qualitative or quantitative defect in one or more components of the
platelet membrane GPIb-V-IX complex. We describe the molecular basis of
a novel Bernard-Soulier syndrome variant in two siblings in whom
GPIb was not detected on the platelet surface but that was present
in a soluble form in plasma. DNA sequence analysis showed that the
affected individuals were compound heterozygotes for two mutations.
One, inherited from a maternal allele, a T777 C point
mutation in GPIb converting Cys65 Arg within the
second leucine rich repeat, the other, a single nucleotide substitution
(G2078 A) for the tryptophan codon (TGG) causing a
nonsense codon (TGA) at residue 498 within the transmembrane region of
GPIb , inherited from a mutant paternal allele. The Bernard-Soulier
phenotype was observed in siblings who were compound heterozygotes for
these two mutations. Although GPIb was not detected on the
surface of the patient's platelets, soluble GPIb could be
immunoprecipitated from plasma. When plasmids encoding GPIb
containing the Cys65 Arg mutation were transiently
transfected into Chinese hamster ovary (CHO) cells stably expressing
the GP -IX complex (CHO IX), the expression of GPIb was similar
to the wild-type (WT) GPIb , but did not bind vWF. When plasmids
encoding GPIb containing the Trp498 stop were
transiently transfected into CHO IX, the surface expression of
GPIb was barely detectable compared with the WT GPIb . Thus, this
newly described compound heterozygous defect produces Bernard-Soulier
syndrome by a combination of synthesis of a nonfunctional protein and
of a truncated protein that fails to insert into the platelet membrane
and is found circulating in plasma.
 |
INTRODUCTION |
THE PLATELET glycoprotein Ib-V-IX complex
consists of four type I membrane-spanning polypeptides that belong to
the leucine-rich motif (LRM) family.1 These proteins have
in common a structural motif containing one or more repeats of
periodically spaced leucines. In addition, these polypeptides have
regions flanking the LRM that are very similar and contain disulfide
loops.2 GPIb consists of two subunits, (140 kD) and (27 kD), which are disulfide linked.2,3 GPIX is
noncovalently associated with GPIb .4 GPV and GPIb-IX
also form a noncovalent complex in the platelet membrane.5
The -subunit of GPIb consists of four major structural domains. The
N-terminus contains seven leucine-rich repeats.6
Immediately outside the platelet membrane is a threonine-, proline-,
and serine-rich region that is highly O-glycosylated; this region is
termed the macroglycopeptide domain. Following the macroglycopeptide
domain is a transmembrane domain of 29 amino acids and a cytoplasmic domain of approximately 100 amino acids.6 The external
portion of the chain, termed glycocalicin (135 kD),7 can be cleaved from the platelet surface. It is found
circulating in normal plasma8 at a concentration of 2.04 ± 0.46 µg/mL.9 The binding site for vWF has been
localized to the N-terminus of the -subunit.10,11
A qualitative or quantitative defect in the GPIb-V-IX complex results
in a rare congenital disorder of platelets initially described by
Bernard and Soulier in 1948.12 This syndrome, which is
inherited in an autosomal recessive manner, is characterized by
decreased numbers of platelets that are large and morphologically abnormal, and a prolonged cutaneous bleeding time.13
Although Bernard-Soulier platelets are characterized by normal
aggregation in response to agonists such as adenosine diphosphate (ADP)
and epinephrine, they do not aggregate or agglutinate in the presence of ristocetin, a process that is dependent on the interaction between
vWF and the platelet glycoprotein Ib-V-IX complex.14 A
critical functional in the binding of vWF to the glycoprotein Ib-V-IX
complex was initially suggested by studies of Bernard-Soulier platelets, in which there was absent surface expression of GPIb, GPIX,
and GPV.15
The expression of the GPIb-V-IX complex is dependent on the coordinated
assembly of at least three gene products, the - and -subunits of
GPIb, and GPIX.16 The molecular basis of Bernard-Soulier syndrome has been characterized in several published cases to date
providing further evidence that each of these subunits has a critical
role in the coordinate assembly of the functional complex. Whereas GPV
has also been shown to be absent in Bernard-Soulier syndrome, it does
not seem to be necessary for the surface expression of the
complex.17
Given that each polypeptide is encoded by its own gene and that the
coordinate assembly of the complex is required, it is surprising that
Bernard-Soulier syndrome is so rare. Most of the mutations
characterized that result in Bernard-Soulier syndrome are within the
GPIb gene. These mutations have been caused by nonsense mutations
producing a truncated GPIb protein18-22 or mutations
that have been localized to the leucine-rich motif (LRM) of
GPIb .23-26 A single case having a mutation in GPIb
that changed a cysteine residue involved in disulfide bonding has also
been described.27 We and other investigators have recently
characterized a mutation within the transmembrane region of GPIb
that affected anchoring of the GPIb polypeptide in platelets and
results in a circulating soluble GPIb .28,29 A number of
mutations have been identified within GPIX, two of which resulted from
an amino acid change in the LRM or the region flanking the LRM in
GPIX,30,31 and two other point mutations that changed a
cysteine to a tyrosine in GPIX32 and another that caused a
nonsense codon.22 There has been a single published report
of a mutation within the promoter for GPIb that resulted in
Bernard-Soulier syndrome.33
This report describes the molecular genetic basis for a novel variant
mutation within the gene coding for GPIb that is responsible for
Bernard-Soulier syndrome.
 |
MATERIALS AND METHODS |
Case History
A 5-year-old girl and her 20-year-old brother from eastern Iceland were
diagnosed as having Bernard-Soulier syndrome. The boy presented at 15 months of age with easy bruising and a platelet count of 29,000 to
67,000/mm3. He was treated initially with steroids. At 5 years of age, he underwent a splenectomy, as he was believed to have
idiopathic thrombocytopenic purpura. At 8 years of age, an episode of
epistaxis required hospital admission, and large platelets were noted
on a blood smear. Platelet aggregation studies showed normal response to adenosine diphosphate (ADP), epinephrine, collagen, and arachidonic acid, with no response to ristocetin. The platelet count was
120,000/mm3, the bone marrow aspirate was normal, and the
platelet count has remained at approximately 120,000/mm3
since the splenectomy. The younger sister was first admitted to
hospital at 16 months of age because of episodes of bleeding and easy
bruising. Her bleeding time was prolonged (>13 minutes) and platelet
count was 75,000/mm3. She has had several episodes of
bleeding requiring transfusion. There are six other siblings, none of
whom has any bleeding symptoms. The mother and father are unrelated and
unaffected clinically with normal platelet counts and morphology.
Monoclonal antibodies and reagents.
The anti-GPIb antibody AP-1 blocks vWF binding to
GPIb .14 MBC 142.2, 142.6, and 142.11 are monoclonal
antibodies (MoAbs) raised against purified GPIb that do not inhibit
the binding of vWF to GPIb . An anti-GPIX MoAb (FMC 25) was purchased
from Harlan Bioproducts (Indianapolis, IN). AP2 is a MoAb against the GPIIb-IIIa complex.34 An affinity-purified platelet
GPIb -specific rabbit polyclonal antibody4 was a generous
gift of Dr Sandor S. Shapiro (Cardeza Foundation for Hematologic
Research, Philadelphia, PA).
Purified glycocalicin was obtained from outdated platelets as
described35 and provided by Dr P.A. Kroner (Blood Center of Southeastern Wisconsin). Botrocetin was purified according to the
method of Andrews et al.36
Blood.
Blood samples from the patients and the patient's parents were
collected into acid-citrate-dextrose (National Institutes of Health
formula A) and shipped by courier to Milwaukee. The samples arrived
within 72 hours and were processed immediately. Because proteolysis of
the extracellular portion of GPIb could result in the decrease of
detectable GPIb on the platelet surface, blood samples were obtained
simultaneously from three normal volunteers in Iceland and shipped with
the patient samples. Platelet-rich plasma (PRP) from the parents and
normal volunteers was prepared by centrifugation at 800g for 2 minutes. Platelets were isolated and washed three times by differential
centrifugation and resuspended in a buffer containing 96.5 mmol NaCl,
85.7 mmol glucose, 1.1 mmol EDTA, 8.5 mmol Tris with 50 ng/mL
prostaglandin E1 (PgE1) (Sigma Chemical Co, St
Louis, MO). Because Bernard-Soulier platelets are typically large and
morphologically abnormal, a previously described sedimentation
technique was used to isolate platelets from the
patients.29
Platelet lysates were prepared by resuspending the platelet pellet in
500 µL of lysis buffer (96.5 mmol NaCl, 85.7 mmol glucose, 1.1 mmol
EDTA, 8.5 mmol Tris, 5 mmol N-ethylmaleimide, 100 µg/mL leupeptin, 1 mmol phenylmethylsulfonyl fluoride [PMSF], and 1% Triton X-100
[Pierce, Rockford, IL]). The lysate was vortexed for 3 minutes and
then centrifuged at 4°C for 10 minutes at 16,000g. Aliquots
of platelet lysate and platelet-poor plasma (PPP) were frozen at
80°C until analyzed.
Immunoblotting.
Platelet lysates were separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on an 8% gel
according to Laemmli.37 The separated proteins were
electroblotted onto a polyvinylidine difluoride (PVDF) membrane (Novex,
San Diego, CA) as described by Towbin et al,38 blocked in
phosphate-buffered saline (PBS) containing 5% powdered milk, and then
incubated overnight with the anti-GPIb MoAbs MBC 142.6 or MBC 142.11 or the affinity-purified anti-GPIb polyclonal antibody. The membrane
was washed three times with PBS containing 5% powdered milk, incubated
with a goat anti-mouse or donkey anti-rabbit IgG conjugated with
horseradish peroxidase (HRP), washed again three times, and treated
with SuperSignal Substrate (Pierce).
Immunoprecipitation.
GPIb MoAb 142.2 was coupled to cyanogen bromide-activated Sepharose
4B beads (Sigma). PPP was precleared by incubating with uncoupled
Sepharose CL-4B beads for 1 hour at room temperature. The beads were
centrifuged at 1,000g and the plasma added to the antibody-coupled beads and incubated overnight at 4°C. The beads were
washed and the immunoprecipitated complexes from plasma eluted in 2%
SDS. All samples were boiled at 100°C for 3 minutes. The samples were
then analyzed by SDS-PAGE on an 8% to 16% exponential gradient in the
presence of 20 mmol dithiothreitol. Immunoblotting was performed in the
same manner as described above, using the antibody MBC 142.11.
Flow cytometry analysis of platelets in whole blood.
The platelet GPIb-IX complex and GPIIbIIIa were analyzed by flow
cytometry, using a two-color, two-antibody technique.39 A
total of 100 µL of whole blood was diluted 1:10 in PBS and divided into six 50-µL aliquots. Samples were then either unstained,
incubated with 2 µg/mL of mouse IgG as a negative control, 2 µg/mL
of fluorescein isothiocyanate (FITC)-conjugated MoAb-AP1, 2 µg/mL of
FITC-conjugated-AP2, a combination of a biotin-conjugated AP2 plus
FITC-AP1, or a combination of a biotin-conjugated AP1 plus
FITC-conjugated AP2. The samples were incubated in the dark for 20 minutes at room temperature. Subsequently, streptavidin-conjugated
phycoerythrin (PE) was then added to each sample except the unstained
control. The samples were incubated for an additional 10 minutes in the
dark at room temperature and analyzed immediately in a Becton Dickinson
(San Jose, CA) FACScan flow cytometer. Fluorescence was used to
identify the platelet population with AP2; the samples were then
analyzed for AP1 fluorescence. This technique demonstrated that the
anti-GPIb MoAb AP1 failed to bind platelets that were recognized by
the anti-GPIIbIIIa antibody. Further experiments were then performed to
evaluate the surface expression of GPIb and of GPIX on platelets using the anti-GPIb antibodies 142.2 and 142.11 and the anti-GPIX antibody FMC-25. In these experiments, platelets were identified and
gated, both by their PE-AP2 fluorescence intensity and by their
physical properties on a forward versus side-scatter plot. Data for
these platelets were collected through this gate and were analyzed for
fluorescence with the antibodies 142.2 and 142.11 and FMC-25.
PCR amplification of genomic DNA.
Genomic DNA was isolated from peripheral blood lymphocytes (PBLs) as
described.40 DNA was amplified by the polymerase chain reaction (PCR), using primer pairs based on the published genomic sequence of GPIb .41 For DNA sequence analysis, the
full-length coding region for mature GPIb was amplified with primers
162-181 (GGCCTGCATTTCCTCCTCACC) and 2653-2634 (AAGCTCCCGATGCTGCATGGG). The target sequences were amplified in a 50-µL reaction volume containing 500 to 1,000 ng of genomic DNA, 30 pmol of each primer, and
0.2 mmol of each dNTP in a reaction buffer consisting of 60 mmol/Tris-HCl pH 9.0, 15 mmol
(NH4)2SO4, 2 mmol/L
MgCl2 and 1 U of Taq polymerase (Perkin Elmer, Foster City,
CA) and 4% (vol/vol) DMSO. PCR amplification was performed in a
programmable thermal cycler (model 9600, Perkin Elmer) for 35 cycles of
45 seconds denaturation at 96°C, annealing for 1 minute at 60°C,
and extension for 1 minute at 72°C. PCR products containing the
entire coding region for GPIb were cloned into the pCRII.1 cloning
vector using the TA cloning kit (Invitrogen, San Diego, CA).
DNA sequencing.
Direct sequence analysis of the entire coding region of PCR-amplified
GPIb from each subject and a minimum of three clones each from the
two patients, the mother, and father was performed using the Prism
Ready Reaction DyeDeoxy terminator cycle sequencing kit and an Applied
Biosystems (Foster City, CA) model 373A DNA Sequencer. Sequencing
primers were synthesized on an Applied Biosystems model 394/DNA
synthesizer.
Transient expression.
A Bsg I and BsrGI restriction fragment (nucleotides
218-847) of the subcloned GPIb PCR product amplified from genomic
DNA containing the T C substitution at nucleotide 777 in GPIb
(Cys65 Arg) was subcloned into pGEM-7 containing the
WT GPIb cDNA, from which a BsgI and BsrGI
restriction fragment had been excised. An XhoI/MluI
restriction fragment, containing the entire coding region for GPIb ,
was then excised from this pGEM-7GPIb C65 R and
inserted into the mammalian expression vector pCI-NEO (Promega,
Madison, WI), which carries the human cytomegalovirus (CMV) promoter
and the SV40 origin of replication. This expression vector
(pCI-NEOGPIb C65 R) now contained the entire coding
region for GPIb with the point mutation at codon 65. In a similar
manner, a Pst I restriction fragment (nucleotides 1246-2206 and
containing the G A substitution at nucleotide 2078 resulting in
W498 stop) of the subcloned GPIb PCR product was
subcloned into pGEM-7 containing the WT GPIb cDNA, from which a
Pst I restriction fragment had been excised. Again, an
Xho I/Mlu I restriction fragment, containing the entire
coding region for GPIb , was excised from pGEM-7GPIb W498 stop and inserted into the expression
vector pCI-NEO. This expression vector
(pCI-NEOGPIb W498 stop) now contained the entire
coding region for GPIb with the point mutation at codon 498. Constructs containing both the WT and mutant GPIb were sequenced to
ensure that no additional mutations had been introduced.
For transient expression studies, CHO IX cells (kindly provided by
Dr José A. López, Baylor College of Medicine, Houston, TX)
were used. CHO IX cells are CHO cells that stably surface express
human GPIb and GP IX at high levels.42 These cells were
additionally transiently transfected with either the WT GPIb , the
construct containing the pCI-NEOGPIb C65 R, the
construct containing pCI-NEOGPIb W498 stop or
mock-transfected with the plasmid pCI-NEO alone. Expression plasmids
were introduced into CHO IX cells in the presence of lipofectamine
(GIBCO-BRL), following the protocol of Felgner et al.43 In
brief, 1.5 × 106 cells were plated in 100-mm dishes and
grown overnight. 6.6 mL of OPTI-MEM-reduced serum media (GIBCO-BRL)
containing 72 µg of lipofectamine and 6 µg of the appropriate
plasmid DNA was added, and the cells were incubated for 5 hours. The
transfection media was removed and 8 mL of culture media was added;
incubation was continued at 37°C for 48 hours.
Transfected cells were detached from tissue culture plates with 3 mmol
EDTA, centrifuged at 250g and resuspended in HBSS with 1%
bovine serum albumin (BSA) and 1% normal donkey serum. 3 × 105 cells were transferred to each well of a 96-well
V-bottom plate (Dynatech, Chantilly, VA) and incubated for 30 minutes
simultaneously with 5 µg/mL of vWF, 1 µg/mL of botrocetin the
anti-GPIb antibody MBC 142.2, and a rabbit polyclonal antibody to
vWF (5 µg/mL and 3 µg/mL, respectively). A concentration of 1 µg/mL of botrocetin was used, as previous investigations from our
laboratory have shown no significant difference in vWF binding with 1 µg/mL of botrocetin as compared with 5 µg/mL.44 The
cells were then washed twice and incubated for an additional 30 minutes
in a darkened room with a 1:100 dilution of PE-conjugated
affinity-purified F(ab )2 donkey anti-mouse IgG and a 1:320
dilution DTAF-conjugated affinity-purified F(ab )2 donkey
anti-rabbit IgG (Jackson Immunoresearch Laboratories, West Grove, PA)
to detect vWF binding in cells expressing GPIb . The cells were then
washed twice, resuspended in 2% paraformaldehyde, and analyzed in a
Becton Dickinson FACScan flow cytometer.
 |
RESULTS |
GPIb Is Undetectable on the Patient's Platelet Surface
FACS analysis of whole blood showed that the MoAb AP1 failed to
recognize GPIb on the platelet surface of these two patients (Fig
1). Although there was no detectable
binding of AP1 to platelets from either of the affected siblings, the
binding of AP1 was similar in both parents, as compared with three
normal controls. By contrast, binding of AP2 was normal in both
patients and their parents (data not shown). Further analysis of
platelets from the eldest patient showed that neither of the
anti-GPIb antibodies, 142.2 and 142.11, bound to platelets (Fig
2). By contrast, the expression of GPIX was
normal in the patients platelets. Immunoblot analysis of platelet lysate with the monoclonal antibodies MBC 142.6 confirmed the absence
of GPIb in either of the patient's platelets (Fig
3). Immunoblot analysis of platelet lysate
under reduced conditions with the anti-GPIb polyclonal antibodies
demonstrated that GPIb was present in the patients platelets, albeit
in markedly reduced amounts (Fig 4).

View larger version (18K):
[in this window]
[in a new window]
| Fig 1.
Flow cytometric analysis of patients' and parents'
platelets. Analysis was performed on whole blood with monoclonal
antibodies against GPIb (AP1) and GPIIbIIIa (AP2). Platelets were
then analyzed for their binding to AP1. Filled area, mother and
father; clear area, affected children. The results from
analysis of an additional three normal volunteers are shown by the
dashed lines overlapping the normal sample in the shaded
area. There is no detectable GPIb on the platelets of the two
children, whereas the samples from the two parents are similar to those
of the normal controls.
|
|

View larger version (24K):
[in this window]
[in a new window]
| Fig 2.
Flow cytometric analysis of patients' and normal
platelets. Analysis was performed on whole blood with monoclonal
antibodies against GPIb (AP1) and GPIIbIIIa (AP2). Platelets were
then analyzed for their binding to the anti-GPIb antibodies AP1
(solid bold line), 142.2 (solid line), and 142.11 (dashed line), the anti-GPIX antibody (hatched area),
and an irrelevant mouse IgG (gray area). The anti-GPIb
antibodies bind to normal platelets, but not to those in this patient.
There are similar amounts of GPIX on the surface of platelets from the
patient and a normal volunteer.
|
|

View larger version (86K):
[in this window]
[in a new window]
| Fig 3.
Western blot analysis of GPIb in platelet lysate.
Platelet lysate from a normal volunteer, the parents, and the two
affected children was analyzed by immunoblotting with the
GPIb -specific monoclonal antibody 142.6. GPIb is readily
detectable in the normal volunteer and in both parents, but not in the
children.
|
|

View larger version (61K):
[in this window]
[in a new window]
| Fig 4.
Western blot analysis of GPIb in platelet lysate.
Platelet lysate from a normal individual and the affected brother was
analyzed by immunoblotting with an anti-GPIb polyclonal antibody. A
total of 11 µg and 168 µg of protein was loaded on the gel from the normal individual and patient respectively. GPIb is readily
detectable in the normal control but is significantly reduced in the
patient.
|
|
Soluble GPIb can be immunoprecipitated from the
patient's plasma.
Immunoprecipitation of plasma with MBC 142.2 and immunoblotting with
MBC 142.6 demonstrated the presence of a protein of approximately 130-kD in both siblings and their parents. This band had a mobility similar to that of purified glycocalicin. However, this was
significantly reduced in both patients compared to their parents (Fig
5). Thus, it seems unlikely that the
absence of detectable GPIb on the patient's platelets was caused by
cleavage of glycocalicin from the platelet surface, as this would
result in a greater amount of circulating glycocalicin.

View larger version (86K):
[in this window]
[in a new window]
| Fig 5.
Western blot analysis of plasma GPIb . Platelet-poor
plasma was immunoprecipitated with 142.2, analyzed by SDS-PAGE on an 8% to 16% exponential gradient in the presence of
-mercaptoethanol, and immunoblotted with MBC 142.6. Plasma samples
from the parents and the normal volunteer were diluted 1:2. Each
patient's plasma contains a soluble GPIb , similar to glycocalicin,
although there is significantly less in the two patients as compared
with the parents and normal sample.
|
|
Patients have compound heterozygous mutations within the
GPIb gene.
To determine the molecular basis for the absence of GPIb , we
amplified the entire coding region of GPIb from both patients' genomic DNA. The PCR-amplified DNA of both patients were of the predicted size according to the published sequence.41
Direct sequence analysis of PCR-amplified DNA showed a heterozygous T C substitution at nucleotide 777 and a heterozygous G A
substitution at nucleotide 2078 (Fig
6). The T C substitution changes a
free cysteine within the second leucine-rich repeat of GPIb to an arginine. The G A substitution results in a premature
stop codon within the transmembrane region of GPIb .

View larger version (35K):
[in this window]
[in a new window]
| Fig 6.
Mutations within GPIb . DNA sequence analysis of
GPIb from a normal individual (A and C) and from the patients (B and
D). Sequence analysis of PCR-amplified DNA showed a T C
substitution at nucleotide 777 (B) and a G A substitution at
nucleotide 2078 (D). Amino acids are numbered above.
|
|
In addition to these mutations, a number of other differences were
noted from the published sequence.6,41 Within the intron, there was an A T polymorphism at nucleotide 497 and a T C polymorphism at nucleotide 532 within the 5 untranslated region of
GPIb . We followed the segregation of these mutations within the
affected family by amplification and direct sequencing of the entire
coding region of both parents. In addition, the entire coding region
was also cloned and sequenced in both parents. An allele from the
mother contained the T C substitution at nucleotide 777; this
allele also contained two of the variable number of tandem repeats in
the macroglycopeptide region. The mother was homozygous for an A in the
A497T polymorphism within the intron, and her WT allele contained only
one of the tandem repeat polymorphisms. The allele from the father
contained the G A transversion at nucleotide 2078. The father was
homozygous for the T polymorphism within the intron and the T C
polymorphism at nucleotide 532 within the 5 untranslated region of
GPIb . Both fathers' alleles contained two of the variable number of
tandem repeats within the macroglycopeptide region. Consequently, the
affected children had inherited the T777 C mutation
from the mother and the G2078 A mutation from the
father.
The mutations are either nonfunctional or not expressed in a
mammalian expression system.
Transfected alone, GPIb is not expressed on the cell surface of CHO
cells in appreciable quantities.16 Studies examining the
role of GPIb and GPIX have shown that all three subunits are
required for efficient expression of the ligand-binding subunit on the
surface of transfected cells.16 Therefore, to investigate the effect of this mutation on surface expression, both the WT GPIb
and the constructs containing the mutations were transiently transfected individually into CHO cells that stably express both GPIb and IX.16 These cells were then incubated with vWF,
botrocetin, and antibodies against GPIb and vWF, and then analyzed
by flow cytometry. Botrocetin was used in these investigations, as the patients' platelets failed to aggregate in the presence of ristocetin. As shown in Fig 7, a significant fraction
(9.77%) of the cells transfected with the WT GPIb construct
exhibited an appreciable increase in surface fluorescence when reacted
with the anti-GPIb antibody 142.11. Furthermore, a significant
number of the cells expressing GPIb bound vWF (2.94%).
Surprisingly, there was an increase in surface fluorescence of cells
transfected with the C65 R construct when reacted with
the anti-GPIb antibody 142.11, which was similar to the WT
transfections, however none of these cells bound vWF. By contrast,
surface expression of the construct containing the W498stop construct
was barely detectable, and none of these cells bound vWF.

View larger version (32K):
[in this window]
[in a new window]
| Fig 7.
Analysis of vWF binding in Chinese hamster ovary (CHO)
IX cells expressing GPIb , and the GPIb C65 R
and GPIb Trp498 stop constructs. The binding of vWF
in the presence of botrocetin was assessed in CHO IX cells that were
mock-transfected (A), in CHO IX cells transiently transfected with
the wild-type (WT) GPIb (B), and in CHO IX cells transfected with
the constructs GPIb Cys65 Arg (C) and
GPIb Trp498 stop (D). The x-axis is fluorescence
detected with an anti-GPIb MoAb. The y-axis is fluorescence detected
with a polyclonal anti-vWF antibody. A: Neither GPIb expression or
binding of vWF is detected in the mock-transfected cells. B: In cells
transfected with the WT GPIb , GPIb is readily detectable on the
cell surface (9.77% of cells) and binds vWF (2.94% of cells). C:
Whereas the GPIb Cys65 Arg construct results in a
significant increase in fluorescence when detected with the
anti-GPIb antibody (6.66%) of cells, there is no binding of vWF. D:
In the cells transiently transfected with the GPIb Trp498
stop construct, there is no significant increase in surface fluorescence when detected with the anti-GPIb antibody, and there is
no binding of vWF.
|
|
 |
DISCUSSION |
A critical event in hemostasis is the interaction of vWF with the
platelet GPIb-V-IX receptor. Defects in the GPIb-V-IX complex result in
the congenital acquired bleeding disorder Bernard-Soulier syndrome. In
the present investigation, we have identified, to the best of our
knowledge, the first patients with these compound heterozygous
mutations within the coding region for the -subunit of the GPIb-V-IX
complex that cause Bernard-Soulier syndrome. Both Western blot and FACS
analysis of platelets from both patients failed to demonstrate any
GPIb ; however, FACS analysis clearly demonstrated GPIb on the
surface of both parents who are heterozygous carriers, similar to
normal volunteers. The clinical diagnosis of Bernard-Soulier syndrome
was suggested by giant platelets and an absence of ristocetin-induced
platelet aggregation.34 The specific diagnosis was
confirmed by detailed platelet membrane glycoprotein analysis and
expression studies. In the present investigation, we used botrocetin as
an agonist to induce binding of vWF to expressed GPIb . Previous
investigations, using either recombinant soluble GPIb 25
or a chimera containing the vWF binding region of
GPIb ,45 have demonstrated no difference in the binding
of vWF to GPIb induced by either ristocetin or botrocetin.
Furthermore botrocetin, like ristocetin, fails to induce agglutination
of platelets from a Bernard-Soulier syndrome patient.46
Because botrocetin forms a soluble complex with vWF,47 a
technical advantage over ristocetin48 when examining the
binding of vWF to GPIb in transfected cells, we used botrocetin as
an agonist to study the role of vWF binding to the recombinant
expressed GPIb . Expression studies confirmed that the mutations
identified in these affected patients resulted in expression of a
nonfunctional protein and the decreased surface expression of GPIb .
The consensus sequence for the leucine rich repeats for GPIb and for
the entire family of leucine-rich repeats is shown in Fig
8. At the sixth residue within the
consensus sequence shown in Fig 8, most proteins in the leucine-rich
repeat family contain asparagine, but three have cysteine in this
position.1 Within GPIb , the cysteine at residue 65 is a
free cysteine residue.49 The functional consequences of
variations of consensus residues at this position are unknown. The
results of our investigation demonstrate that this cysteine is
critically important to the function of the receptor, because a
mutation that alters the cysteine to an arginine results in the
expression of a receptor that does not bind vWF "in response to the
agonist botrocetin" in vitro. Whereas measurement of vWF binding in
the presence of ristocetin in vitro may have provided useful
confirmatory evidence of the platelet studies in vivo, other
investigators have shown that platelets from Bernard-Soulier syndrome
patients do not agglutinate in response to botrocetin when they do not
respond to ristocetin."

View larger version (29K):
[in this window]
[in a new window]
| Fig 8.
Consensus sequence for the leucine-rich motif. The free
cysteine within the second LRM is double-underlined.
|
|
In contrast to the results demonstrated on the patients' platelet
surfaces, the results of the expression studies demonstrate some
surface expression, of the C65 R mutation. This
discrepancy has a number of potential explanations. In vivo disruption
of the normal trafficking pathways of the complex by causing a
conformational change within the protein, as a result of changing a
free cysteine could explain the observed Bernard-Soulier syndrome
phenotype. The results obtained in vitro, using a eukaryotic expression
vector in which transcription is greatly exaggerated may account for
the results seen in vitro. Platelets that lack a nucleus do not have
the same ability to synthesize proteins; consequently, any protein that
may be made in these two patients is below the physiologically relevant
range and results in the phenotype described. However, even when
expressed in an in vitro system the mutant protein clearly failed to
bind vWF.
The precise mechanism whereby a mutation within the leucine-rich repeat
causes Bernard-Soulier syndrome is unclear. Investigations using either
overlapping synthetic peptides11 or site-directed mutagenesis10 have demonstrated that residues
Ser251-Asp287 are critically important for the
binding of vWF to GPIb induced by the agonists ristocetin and
botrocetin. Residues Ser251-Asp287 are located
near the N-terminus of the receptor between the leucine-rich repeats
and the macroglycopeptide region. Curiously, although there have been
several reports of mutations within the leucine-rich region that
resulted in Bernard-Soulier syndrome, to date no mutations described
within the region bounded by residues 251-287 have resulted in
Bernard-Soulier syndrome. Using overlapping synthetic peptides to
delineate the vWF binding region of GPIb , Vincente et
al11 showed that peptides spanning the second and third
leucine-rich repeat inhibited ristocetin-dependent binding of platelets
to vWF to a similar degree as did synthetic peptides between residues 251-287. By contrast, peptides within the second and third
leucine-rich repeat were marginally less effective in inhibiting
botrocetin induced binding of vWF compared to peptides within residues
251-287. The corollary of ristocetin or botrocetin-induced binding of
vWF to GPIb in vivo is unclear. However, the results of these in vitro experiments in conjunction with the mutations described in vivo would
suggest that the structure of the leucine-rich repeats is essential for
residues 251-287 to be able to function in the binding of vWF to GPIb.
The results of the present investigation suggest that the in vivo
mutations that affect C65 within the leucine-rich repeat
not only inhibit adequate platelet surface expression but also disrupt
function of the receptor when expressed in a mammalian cell line.
The postulated transmembrane region of GPIb extends from
Leu486 to Gly514. The transmembrane region is
followed by two charged amino acids that may help anchor the protein
within the platelet membrane; after this region is a cytoplasmic domain
of approximately 100 amino acids. The second mutation described in this
report converts the Trp498 to a stop codon approximately
halfway within the transmembrane region. Although the coordinate
expression of each of the three subunits is required for efficient
surface expression of the complex, in the presence of a truncated
transmembrane region it appears that GPIb is synthesized but fails
to anchor within the platelet membrane since GPIb is found
circulating in plasma and GPIX is found on the platelet surface. These
results are similar to those described in a recent report by Holberg et
al,50 who identified a patient with the W498stop. However,
our expression studies demonstrate for the first time that this
mutation results in the lack of surface expression of GPIb . Although
we have not demonstrated that the W498stop mutant is responsible for
the soluble GPIb found circulating in plasma, previous
investigations both from our laboratory29 and from those of
other investigators21,28,51 have demonstrated that in
patients with Bernard-Soulier syndrome resulting from truncated
versions of GPIb that a soluble form of GPIb is found circulating
in plasma. These "experiments of nature" have been confirmed in
expression studies which have demonstrated that truncated GPIb is
readily detectable in culture media.29,52 Together, these
results strongly suggest that the W498stop mutant explains the soluble
GPIb found circulating in our patients plasma, albeit significantly
reduced, as compared with normal.
These results are analogous to a case of Bernard-Soulier syndrome
previously described by our group,29 in which a mutation within the transmembrane region caused failure of the protein to anchor
within the platelet; however, a soluble form was found in the
patient's plasma.
In the present investigation, GPIb was not detectable on the
platelet surface of the affected patients; however, platelet surface
expression of GPIX was similar to that of a normal control. Transfection experiments have shown that at least three of the polypeptides (GPIb , GPIb , and GPIX) are necessary for efficient surface expression of the GPIb subunit, which is then capable of
binding vWF.16 Therefore, a molecular genetic effect in
either of these three subunits could cause Bernard-Soulier syndrome by a reduction in the vWF binding subunit. The interaction of GPIb with
GPIX is less clear. However, López et al42
demonstrated that in cell lines expressing each combination of only two
of the three subunits, that two polypeptides would only associate in cells containing GPIb . In the present investigation, we
demonstrated the presence of GPIb in platelet lysate, albeit reduced
compared with the normal condition. The results of the present
investigation confirm these experiments of López et al., by
demonstrating normal GPIX expression with detectable GPIb . de la
Salle et al23 also reported similar findings of reduced
levels of GPIb with normal GPIX in a patient with a mutation in the
GPIb subunit. It appears that GPIX can be expressed normally on the
platelet surface with reduced amounts of GPIb and absent GPIb .
In summary, we have identified and characterized a novel BSS resulting
from compound heterozygous mutations within the GPIb gene. One
mutation changes a free cysteine within the leucine-rich motif and
changes the functional surface expression of GPIb , the other
mutation causes a premature stop codon within the transmembrane region,
so that the mutant peptide does not anchor within the plasma membrane
and is found circulating in plasma. Each of these mutations, when
inherited together with a normal allele in the family reported, does
not cause any symptoms. However, compound heterozygotes for these
mutations result in the observed phenotype of Bernard-Soulier syndrome.
 |
FOOTNOTES |
Submitted October 16, 1997;
accepted March 6, 1998.
Supported by US Public Health Service Grants No. HL56027 (D.K.),
HL44612, and HL33721 (R.R.M.) and by American Heart Association Grant
No. 95007200 (D.K.).
Address reprint requests to Dermot Kenny, MD, Center for
Cardiovascular Science, The Royal College of Surgeons in Ireland, 123 St Stephen's Green, Dublin 2, Ireland.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" is accordance with 18 U.S.C. section 1734 solely to indicate this fact.
 |
ACKNOWLEDGMENT |
The authors thank Dr Philip A. Kroner for providing glycocalicin, Dr
Peter J. Newman for his critical review of the manuscript, and Dr
Hannes Sigmarsson for assistance with the clinical samples.
 |
REFERENCES |
1.
Kobe B,
Deisenhofer J:
The leucine-rich repeat: A versatile binding motif.
Trends Biochem Sci
19:415,
1994[Medline]
[Order article via Infotrieve]
2.
López JA:
The platelet glycoprotein Ib-IX complex.
Blood Coagul Fibrin
5:97,
1994[Medline]
[Order article via Infotrieve]
3.
López JA,
Chung DW,
Fujikawa K,
Hagen FS,
Davie EW,
Roth GJ:
The and chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence.
Proc Natl Acad Sci USA
85:2135,
1988[Abstract/Free Full Text]
4.
Wu G,
Meloni FJ,
Shapiro SS:
Platelet glycoprotein (GP) IX associates with GPIb![]() |