|
|
Previous Article | Table of Contents | Next Article 
Blood, Vol. 91 No. 6 (March 15), 1998:
pp. 1882-1890
Characterization and Use of an Antibody Detecting the CBF -SMMHC
Fusion Protein in inv(16)/t(16;16)-Associated Acute Myeloid Leukemias
By
David S. Viswanatha,
I.-Ming Chen,
Pu Paul Liu,
Marilyn L. Slovak,
Cathy Rankin,
David R. Head, and
Cheryl L. Willman
From the Department of Pathology and Cancer Center, University of New
Mexico School of Medicine, Albuquerque, NM; the National Human Genome
Research Institute, National Institutes of Health, Bethesda, MD; the
City of Hope National Medical Center, Duarte, CA; the Southwest
Oncology Group (SWOG) Statistical Center, Seattle, WA; and St Judes
Childrens Research Hospital, Memphis, TN.
 |
ABSTRACT |
The inv(16)(p13q22) and t(16;16)(p13;q22) cytogenetic abnormalities
occur commonly in acute myeloid leukemia (AML), typically associated
with French-American-British (FAB) AML-M4Eo subtype. Reverse
transcriptase-polymerase chain reaction (RT-PCR)
techniques have been recently developed to detect the presence of
several variants of the resultant CBFB-MYH11 fusion gene that
encodes a CBF -smooth muscle myosin heavy chain (SMMHC) fusion
protein. We have now determined the clinical use of a polyclonal
antibody [anti-inv(16) Ab] directed against a junctional epitope of
the most common type of CBF -SMMHC fusion protein (type A), which is
present in 90% of inv(16)/t(16;16) AML cases. Using flow cytometry, reproducible methods were developed for detection of CBF -SMMHC proteins in permeabilized cells; flow cytometric results were then
correlated with cytogenetics and RT-PCR detection methods. In an
analysis of 42 leukemia cases with various cytogenetic abnormalities and several normal controls, the anti-inv(16) Ab specifically detected
all 23 cases that were cytogenetically positive for inv(16) or
t(16;16), including a single AML case that was RT-PCR-negative. In
addition to detecting all type A fusions, the anti-inv(16) Ab also
unexpectedly identified the type C and type D CBF -SMMHC fusion
proteins. Molecular characterization of one RT-PCR-positive and
Ab-positive t(16;16) case with a non-type A product showed a novel
previously unreported CBFB-MYH11 fusion (CBFB nt
455-MYH11 nt 1893). Flow cytometric results were analyzed using
the Kolmogorov-Smirnov statistic D-value and the median value for
positive samples was 0.65 (range, 0.35 to 0.77) versus 0.07 (range,
0.21 to 0.18) in the negative group (P < .0001). The
overall concordance between cytogenetics and RT-PCR was 97%, whereas
the concordance between flow cytometry and cytogenetics was 100%.
Thus, using the anti-inv(16) Ab, all cytogenetically positive and
RT-PCR-positive AML cases with inv(16) or t(16;16) could be rapidly
identified. This study demonstrates the use of this antibody as an
investigational tool in inv(16)/t(16;16) AML and suggests that the
development of such reagents may have potential clinical diagnostic
use.
 |
INTRODUCTION |
THE CHARACTERIZATION and identification
of specific genetic abnormalities is critical for the diagnosis and
investigation of the acute leukemias. An association between chromosome
16 rearrangements and acute myelomonocytic leukemia with abnormal,
dysplastic marrow eosinophils was reported nearly 15 years
ago1,2 and subsequently confirmed in several
reports.3-6 The pericentric inv(16)(p13q22) and related
t(16;16)(p13;q22) cytogenetic abnormalities are observed in
approximately 10% of de novo acute myeloid leukemia (AML) cases; such
neoplasms are typically characterized by a strong association with
French-American-British (FAB) AML-M4Eo morphology7 and relatively favorable therapeutic outcome.2,8-12 Both of
these cytogenetic events result in the molecular fusion between the CBFB gene on 16q22 (encoding core binding factor -subunit
[CBF ]) and the MYH11 gene on 16p13 (encoding a type II
smooth muscle myosin heavy chain [SMMHC]).13 The
resultant chimeric CBF -SMMHC protein is thought to disrupt normal
myelomonopoiesis by acting as a dominant negative inhibitor of the
function of endogenous CBF and its heterodimerizing AML1 (CBF )
partners, thereby altering the expression patterns of critical target
genes.14 A murine CBFB-MYH11 knock-in model has
shown that heterozygous germline introduction of this chimeric gene
abrogates definitive and possibly also primitive embryonic
hematopoiesis and is lethal in utero.15
In cases of CBFB-MYH11 AML studied to date, the CBFB
fusion site is nearly constant at the mRNA level, with few reported
exceptions.14,16,17 However, several different
CBFB-MYH11 transcripts have been described, principally as a
result of heterogeneity in MYH11 genomic
breakpoints,14,16,18,19 or by alternative splicing in
CBFB.20 The large majority (>85%) of cases of
inv(16)/t(16;16) AML are associated with a type A fusion transcript,
corresponding to an in-frame CBFB nt 495-MYH11 nt 1921 junction.14 Given the specificity of fusion genes as
molecular markers in a subset of acute leukemias, appropriate and
timely therapy increasingly depends on the rapid identification of
these entities. Reverse transcriptase-polymerase chain reaction
(RT-PCR) has been widely used for this purpose, including the diagnosis
of CBFB-MYH11 fusions in inv(16)/t(16;16) AML.13,16-22 Although this is an effective and sensitive
technique, RT-PCR requires sufficient cells for adequate RNA isolation
and careful attention to contamination control. In addition, RT-PCR may
not detect all CBFB-MYH11 fusions with primer combinations that
have been previously described.16 Identification of
chimeric protein products arising from specific leukemia-associated
genetic fusions is a potentially rapid and attractive alternative to
nucleic acid-based methodologies. This approach has been recently
reported for detection of the E2A-PBX1 fusion product occurring in
acute lymphoblastic leukemia with the t(1;19)
abnormality.23 Immunocytochemical analysis of altered
macromolecular nuclear structures has also been described for
recognition of the t(15;17)-associated PML-RAR fusion
protein.24 Western blot analysis using CBF antisera has
been used to distinguish the 70-kD type A and 95-kD type D CBF -SMMHC
fusion proteins in inv(16) AML from the normal constituent 21-kD CBF
protein.25 Previously, a novel antibody recognizing the
type A CBF -SMMHC fusion protein was described by Liu et
al.26 This antibody, named anti-inv16, was shown to detect
CBF -SMMHC proteins in a small number of AML cases and transfected
cells using both Western blotting and immunofluorescence
techniques.26 We now demonstrate the successful application
of this antibody using flow cytometric methodology in permeabilized
cells to specifically recognize the inv(16)/t(16;16)-associated
CBF -SMMHC in a large series of AML cases. During the course of this
study, a novel, previously unreported CBFB-MYH11 fusion mRNA
was also identified in a case of t(16;16) AML.
 |
MATERIALS AND METHODS |
Patient data and samples.
Patients enrolled in various Southwest Oncology Group (SWOG) leukemia
trials (S8600,27 S9031,28 S9034,
S9126, S9129,29 and S9300), with cytogenetic inv(16) or
t(16;16) abnormalities, were selected for study. Control cases were
randomly selected from these SWOG trials, as well as from patient
records at the University of New Mexico (UNM). A total of 38 SWOG
patients, 3 non-SWOG patients [including cases with inv(16) or other
abnormalities], and normal blood and bone marrow samples established
the study group. Pretreatment clinical and pathologic data were
obtained from the SWOG Statistical Center in Seattle, WA, or the
University of New Mexico Hospital. Cytogenetic data on all SWOG
patients except 1 (patient no. [PN] 36, Table 1; probable chronic myelogenous leukemia [CML]) were centrally reviewed; non-SWOG
cytogenetic data from two UNM patients were analyzed by Dr T. McConnell
(SWOG Cytogenetics Committee and UNM Cytogenetics Laboratory). For SWOG leukemia patients, pretreatment routinely stained bone marrow and
peripheral blood slides along with centrally performed cytochemical stains (Sudan black B, ANB, ANA) were reviewed by members of the SWOG
Leukemia Review Panel. Cryopreserved patient bone marrow or blood
samples were accessed through the SWOG Leukemia Repository and the UNM
Center for Molecular and Cellular Diagnostics tissue banking facility,
UNM Cancer Center. Statistical analysis was performed at the SWOG
Statistical Center (Seattle, WA). Cytogenetic and morphology reviews,
flow cytometry, and RT-PCR analysis were all performed in blinded
fashion, without concurrent knowledge of the individual results.
RT-PCR for CBFB-MYH11.
Total RNA was isolated from cell pellets or suspensions using RNazol B
(Tel-Test, Inc, Friendswood, TX), according to the manufacturer's directions. One to two micrograms of RNA was reverse transcribed from random hexamers in a total volume of 20 µL
containing 50 mmol/L KCl, 10 mmol/L Tris (pH 8.4), 5 mmol/L
MgCl2, 1 mmol/L dNTP, 50 pmol random hexamer, 1 U/µL
RNAsin (Promega, Madison, WI), 5 mmol/L dithiothreitol
(DTT), and 100 U Moloney's murine leukemia virus-RT
(MMLV-RT; GIBCO-BRL Life Technologies, Grand Island, NY),
under the following conditions: 23°C for 10 minutes, 42°C for
60 minutes, 95°C for 5 minutes, and 5°C hold. PCR
amplifications were subsequently performed in a 50 µL volume (10 mmol/L Tris, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 200 µmol/L dNTP, 20 pmol of each primer, and 2.5 U Taq
polymerase [Perkin-Elmer/Roche, Branchburg, NJ]), using 7.5 µL of
cDNA for each of inv(16) primer sets C1-M1 and C1-M213 and
5 µL for the 2-microglobulin control primer set. Cycling parameters were 95°C for 30 seconds, 59°C for 45 seconds, and 72°C for 90 seconds for 3 cycles, and then 95°C for 30 seconds, 57°C for 30 seconds, and 72°C for 60 seconds for 30 cycles. The PCR was preceded by an initial 5 minutes of denaturation at 95°C and followed by a terminal 8 minutes of extension at 72°C. Primer sequences are as follows (all 5 to 3 ): C1,
GCAGGCAAGGTATATTTGAAGG; M1, CTCTTCTCCTCATTCTGCTC; M2,
ACTGCAGCTCCTGCACCTGC; doM3 , CGTTCTTGCCCACGTCAT; 2M,
5 -GAAAAAGATGAGTATGCCTG; 2M,
3 -ATCTTCAAACCTCCATGATG.
PCR products were analyzed by electrophoresis in 1.5% agarose gels
(Seakem ME; FMC Bioproducts, Rockland, ME), vacuum transferred to nylon
membranes (Pall Biodyne, East Hills, NY), and UV
cross-linked. Membranes were subsequently hybridized with a
biotinylated CBFB oligonucleotide sequence (inv16
probe-ATAGAGACAGGTCTCATCGG)13,18 or a novel biotinylated
junctional sequence (GACACGCGACAGCTCCAAGG) and detected by
chemiluminescence (ECL System; Amersham Life Sciences, Arlington
Heights, IL) on autoradiograph film (Kodak XAR; Eastman Kodak, Rochester, NY). In certain instances, a 0.8-kb
CBFB cDNA13 or a PCR-generated 550-bp 3
CBFB cDNA fragment were 32P-labeled by nick translation
and used as probes. All PCR primers and oligoprobes were synthesized by
the UNM Protein Chemistry facility.
DNA sequence analysis.
PCR products were ligated into pCR 2.1 vector using the Invitrogen T-A
cloning kit (Invitrogen, San Diego, CA) and used to transform DH5
Escherichia coli, according to the manufacturer's instructions. Transformants were spread onto kanamycin X-gal-coated plates. Several white colonies were selected for minipreparations. After plasmid isolation and EcoRI (Promega) digestion, agarose gel analysis confirmed inserts of the correct size. Selected clones were sequenced in both directions using 35S dATP and the
Sequenase v 2.0 method (US Biochemicals, Cleveland, OH)
with forward and reverse primers C1 and M1, respectively. Sequencing
reactions were analyzed on a 6% polyacrylamide gel (Sequagel-6;
National Diagnostics, Atlanta, GA) under standard conditions. Manual
sequencing was repeated twice from different clones and the sequence
data compared with published CBFB13 and MYH11
(K. Okajima, unpublished, GenBank Accession No. X69292, 1992)
cDNA sequences.
Flow cytometric analysis with anti-inv16 Ab.
On initial receipt, samples were enriched for leukemic blasts by
Ficoll-Hypaque (Pharmacia LKB, Piscataway, NJ) density gradient centrifugation under sterile conditions. Cells were cryopreserved in
90% fetal calf serum/10% dimethyl sulfoxide and stored
at 135°C. For this study, cryopreserved cells were defrosted
rapidly, pelleted, and resuspended in PAB (phosphate-buffered saline
[PBS], albumin, and Na azide) before staining. Viability was
determined by trypan blue exclusion and was greater than 90% in all
cases. CD34-fluorescein isothiocyanate (Becton Dickinson, Mountain
View, CA) was used to allow simultaneous identification
of the leukemic blast subpopulation, where applicable. After staining,
cells were washed twice with Hank's balanced salt solution (HBSS),
fixed with 3.7% formaldehyde/PBS for 10 minutes at room temperature,
and then permeabilized with 50% acetone/HBSS for 5 minutes at 4°C
or, alternatively, with 0.05% Tween 20/PBS for 15 minutes at 37°C.
Both permeabilization methods were found to yield comparable flow
cytometric results. After two washes with HBSS, cells were resuspended
in PAB and 4 µL of anti-inv16 Ab was added for incubation at 4°C
for 40 minutes. Polyclonal anti-inv16 Ab is an affinity-purified rabbit
antibody recognizing an 18 amino acid epitope region spanning the
fusion site in the type A CBF -SMMHC chimeric protein of the
inv(16)/t(16;16) abnormality.26 Polyclonal rabbit IgG was
used as isotype control. After incubation, cells were washed and
stained with phycoerythrin-conjugated goat antirabbit Ig
for 30 minutes at 4°C. Cells were then washed twice, suspended in
200 µL of PAB, and analyzed on a FACScan cytometer (Becton Dickinson)
using LYSIS II software with gating to exclude the lymphocyte region.
Both the median fluorescence channel intensity shift and D-value
(calculated from Kolmogorov-Smirnov statistics) were used in the
analysis of flow cytometry data. Validation of the D-value statistic
for comparative flow cytometric assessment of samples has been
previously described.30,31
Cell dilution/sensitivity studies.
Viable cells from a t(16;16)-positive AML (PN 19, Table 1) with a type
A CBFB-MYH11 fusion were diluted into either normal bone marrow
or negative control leukemic sample cells (PN 30, Table 1) as follows:
100% t(16;16), 1:1, 1:5, 1:10, 1:20, 1:50, 1:100, 1:103,
1:104, and 100% negative control. Samples were split
proportionately for flow cytometry and RT-PCR. Total RNA was isolated
immediately and RT-PCR performed as described above. After PCR and gel
transfer, blots were probed with a type A junctional sequence
oligoprobe (5 -GCTCATGGACCTCCATTTCC). Flow cytometric
analysis with anti-inv16 Ab was performed as outlined above, with
the exception that a greater number of events were collected per
dilution.
Statistical methods.
Distributions of median channel shifts and D-values were compared
between subgroups of patients using the Wilcoxon rank sum test, with
results reported as two-tailed P values.
 |
RESULTS |
Patient pretreatment characteristics.
In total, 42 samples from leukemia patients and normal controls were
selected for this study. The median patient age was 40 years (range, 2 to 80 years), and the male:female ratio was 1:1. The median
presentation white blood cell count among these patients was 41.4 (range, 1.6 to 229.8), and the median bone marrow blast count
was 70% (range, 3% to 95%). Cytogenetic data were reviewed in 41 patients, 23 of whom were reported to have an inv(16) or t(16;16); 11 patients had other leukemia-associated karyotypic abnormalities,
including t(8;21), t(15;17), t(9;22), and del(16q). Six AML cases had
normal cytogenetics. One patient (PN 24, Table 1) had a suspected
chromosome 16 abnormality [?del(16q) v inv(16)] in a
diagnostic specimen. Morphologic classifications were available for 36 patients. The inv(16)/t(16;16) cases included AML-M1, M2, and M4 FAB
subtypes. Only 8 of 21 (38%) morphologically reviewed inv(16)/t(16;16)-positive leukemias were characterized by the presence
of classical abnormal eosinophils (M4Eo or M2Eo); however, abnormal
eosinophils were also noted in 2 cases not associated with these
karyotypes. Controls included a spectrum of AML cases, as well as 1 case of chronic myeloid leukemia, 2 acute lymphoblastic leukemias, and
normal peripheral blood and bone marrow. Pretreatment patient data,
morphologic classification, and cytogenetic features on these patients
are summarized in Table 1.
RT-PCR analysis for CBFB-MYH11 fusion.
Forty leukemia samples, including inv(16)/t(16;16) AML and controls and
1 peripheral blood specimen, were analyzed for the presence of the
chimeric CBFB-MYH11 mRNA by RT-PCR, the results of which are
presented in Table 1. Twenty-two of 23 cytogenetically confirmed
inv(16)/t(16;16) cases were PCR-positive and of these, 20 (91%)
demonstrated the common CBFB nt 495-MYH11 nt 1921 type A fusion transcript (415-bp PCR product, PN 2 through 19 and PN 21, Table 1). One each of type C and type D fusions were identified (1.2-kb
and 1.4-kb PCR fragment lengths, PN 1 and PN 23, respectively, Table
1). All positive PCR results were confirmed by hybridization with the
internal CBFB oligonucleotide probe
(Fig 1A and B).

View larger version (71K):
[in this window]
[in a new window]
| Fig 1.
Detection of CBFB-MYH11 fusion transcripts
by RT-PCR. (A) Agarose gel electrophoresis of C1-M1 primer set
amplification products. (B) Hybridization of PCR products with the
inv(16) CBFB internal oligoprobe. In both panels, lane numbers
1 through 6 correspond to samples from PN 14, 13, 22, 1, 18, and 23, respectively (Table 1). Lane 7 represents a relapse sample from PN 23. Lane 8 is a negative control (no RNA). Sample from PN 22 (lane 3)
displays a prominent, but slightly smaller PCR product than expected
for a type A fusion (~400 bp in [A]) and does not hybridize with
the oligoprobe (B). This PCR product did hybridize positively with a
0.8-kb CBFB cDNA probe (not shown). Lane 4 demonstrates a type D fusion; lanes 6 and 7 show a type C fusion.
|
|
A strong correlation between cytogenetic and PCR findings was
observed, with a 97% overall concordance (38 of 39 cases analyzed by
both methods). PCR positivity in the absence of a karyotypic inv(16) or
t(16;16) was not encountered. Conversely, one cytogenetically confirmed
inv(16) AML (PN 20, Table 1) was PCR negative with the primer sets
used, despite the presence of amplifiable cDNA. One other unusual case
(PN 24, Table 1), with a suspected chromosome 16 abnormality,
demonstrated PCR negativity for CBFB-MYH11 transcript in both
diagnostic and relapse samples. Because of the lack of an unequivocal
karyotype in the diagnostic sample from PN 24, this case was not
considered in the concordance analysis. These latter cases are
discussed in further detail below (see "Atypical Cases"). All
negative controls in this study lacked the CBFB-MYH11 fusion by
RT-PCR analysis.
Flow cytometry with anti-inv16 Ab.
All 42 subjects were evaluable by flow cytometry with anti-inv16
Ab. Twenty-four anti-inv16 Ab positive cases were identified; interestingly, these included the two non-type A fusions noted by
RT-PCR analysis. Representative flow cytometric results with anti-inv16
Ab are shown in Fig 2 and summarized in
Table 1. Simultaneous dual-color measurement of CD34 allowed enhanced
delineation of the blast population in many cases. In positive samples,
both low granularity CD34(+) blasts and higher granularity
CD34( ) cells had detectable CBF -SMMHC fusion protein,
although the fluorescence intensity was slightly greater in the CD34(+)
population (data not shown).

View larger version (22K):
[in this window]
[in a new window]
| Fig 2.
Anti-inv16 antibody detection of CBF -SMMHC fusions.
Flow cytometric detection of CBF -SMMHC using anti-inv16 Ab. The
black trace represents isotype control. The gray trace represents
anti-inv(16) Ab. (A and B) PN 13 and PN 21, respectively, demonstrating
detection of type A fusion product; (C) PN 1 with type D fusion
detected by anti-inv16 Ab; (D) PN 22 with novel CBFB-MYH11
fusion; (E and F) PN 28 and PN 30 negative controls. Refer to Table 1
and text for details.
|
|
The median value of the fluorescence median channel shift (MCS) among
positive cases was 53 (range, 24 to 87) versus 5 (range, 16 to
28) for negative cases (P < .0001). Similarly, the median of
the calculated D-value for positive samples was 0.65 (range, 0.35 to
0.77), compared with 0.07 (range, 0.21 to 0.18) in the negative
group (P < .0001). A D-value greater than 0.35 or MCS of
greater than 30 with anti-inv16 Ab established a positive result in
this study, although the MCS was found to exhibit greater variability in a given case, in repeated experiments. Using these criteria, positive and negative flow cytometric results were perfectly concordant with the presence or absence of the inv(16)/t(16;16) karyotypic abnormality, respectively (100% of 40 cases analyzed with combined data available). It is of note that the diagnostic AML sample from 1 case with an indeterminate chromosome 16 abnormality (PN 24, Table 1)
was positive with anti-inv16 Ab, despite the lack of a
CBFB-MYH11 fusion by PCR analysis (see below, "Atypical
Cases"). In all positive cases, the visual degree of anti-inv16 Ab
fluorescence shift compared with isotype control was adequately
pronounced in the histogram curves.
Atypical cases.
Overall, 3 patients with either discordant results or atypical findings
were encountered. One RT-PCR-negative AML case (PN 20, Table 1) with a
reported inv(16) cytogenetic abnormality was positive with anti-inv16
Ab. This case is considered likely to have alternative CBFB
and/or MYH11 breakpoint/fusion sites that are not
detected with either C1-M1 or C1-M2 primer combinations. This
possibility is supported by the relatively weak, but positive fluorescence intensity shift (flow DV = 0.35, MCS = 32) observed with
anti-inv16 Ab compared with isotype control. Unfortunately, no further
patient material was available for additional molecular analysis in
this case. A second RT-PCR-negative case (PN 24, Table 1) also had a
positive flow result observed in both diagnostic (Table 1) and relapse
(data not shown) specimens from this patient; however,
CBFB-MYH11 RT-PCR analysis was negative. This patient had a
suspected morphologic diagnosis of acute promyelocytic leukemia (AML-M3) with atypical features. This case was characterized by a
uniform population of
CD34 /HLA-DR /CD33+/CD13+/CD56+
granular blasts. Cytogenetic analysis suggested a chromosome 16 abnormality [?del(16q) v inv(16)] in a subset of cells from the diagnostic sample; however, a subsequent study of both diagnostic and relapse samples by metaphase FISH technique (Oncor probe kit; Oncor, Gaithersberg, MD) failed to show an inv(16) or t(16;16) (data
not shown). Using a partial CBFB cDNA probe, Southern
hybridization analysis of the distal CBFB locus in relapse
sample DNA from this second patient did not demonstrate rearrangements
(data not shown). However, resolution of CBFB rearrangements in
inv(16)/t(16;16) AML samples by Southern analysis, as attempted here,
may be significantly compromised by the generation of very large fusion
DNA fragments using typical restriction digests.32 We were
unable to assess for rearrangements in the MYH11 breakpoint
region, as has been described.32 In a previous series of
CD56+ natural killer (NK) phenotype
AML,33 inv(16) or t(16;16) karyotypes were not identified;
however, the total number of reported cases was small. Thus, although
case PN 24 may represent a flow cytometric false-positive with
anti-inv16 Ab, the presence of a cryptic CBFB-MYH11 fusion
cannot be excluded, particularly in light of the difficulty in
adequately karyotyping this AML case. It is of note that no equivocal
results were encountered in any of the other control cases, which
included several AML morphologic subtypes.
Finally, a t(16;16) AML case (PN 22, Table 1) that which had detectable
CBF -SMMHC protein by flow cytometric technique (Fig 2D) demonstrated
a slightly smaller size PCR amplicon than the usual type A product (Fig
1A, lane 3). Furthermore, this PCR product did not hybridize with
the CBFB internal oligoprobe (Fig 1B, lane 3), but did
hybridize with the 0.8-kb CBFB cDNA (data not shown). Sequencing of the PCR product showed a novel CBFB-MYH11 mRNA
fusion at CBFB nt 455 and MYH11 nt 1893 (Fig 3A). This fusion is predicted to have
a 404-bp PCR product size with primers C1 and M1, as observed. RT-PCR
analysis of this leukemic sample with primer C1 and a novel tumor-specific MYH11 primer (doM3 ), followed by
hybridization with a junction-specific oligoprobe (doPR), confirmed the
presence of this new fusion type (Fig 3B, lanes 1 and 2).

View larger version (32K):
[in this window]
[in a new window]

View larger version (43K):
[in this window]
[in a new window]
| Fig 3.
Novel CBFB-MYH11 fusion in t(16;16) AML: PN 22. (A) Partial chimeric cDNA junctional sequence of 400-bp PCR product
from PN 22. Sequencing was performed in both directions using primers C1 and M1. The new CBFB-MYH11 fusion site is shown by an
asterisk at CBFB nt 455 and MYH11 nt 1893. The ORF is
not disrupted by this fusion, but is 12 nt shorter than the type A
fusion. (B) RT-PCR analysis confirming the presence of the new fusion
type in PN 22 AML. PCR was performed using primers C1 and doM3 ,
followed by specific oligonucleotide hybridization (do probe), as
described in the Materials and Methods. Lane 1, PCR amplification of
reverse transcribed cDNA from PN 22 AML sample; lane 2, seminested PCR amplification from aliquot of first round C1-M1 PCR product of PN 22 sample; lane 3, AML-M4 sample lacking the inv(16)/t(16;16) and
CBFB-MYH11 fusion by RT-PCR (this case not included in study group); lane 4, PN 11 sample with type A CBFB-MYH11 fusion by C1-M1 PCR; lane 5, negative control (noRNA).
|
|
Sensitivity of anti-inv16 Ab for detection of minimal disease.
Anti-inv16 Ab flow cytometric analysis of cells from a
t(16;16)-positive AML (PN 19, type A CBF -SMMHC fusion, Table 1)
diluted serially into either normal bone marrow or AML negative control (PN 30, Table 1) cells showed a detection sensitivity in the range of
1:5 to 1:10 (Fig 4A). Selective gating of
CD34+ cells did not appreciably increase the detection
limit. Comparative RT-PCR dilutional analysis demonstrated detectable
CBFB-MYH11 fusion transcript to a level of 1 in 104
cells (Fig 4B). Thus, RT-PCR assays appear to be more sensitive than
flow cytometric analysis with anti-inv16 Ab for minimal disease assessment. Despite its excellent specificity, anti-inv(16) Ab has
relatively low sensitivity, possibly due to low affinity and the need
for cell permeabilization to detect a cytoplasmic epitope.

View larger version (12K):
[in this window]
[in a new window]

View larger version (22K):
[in this window]
[in a new window]
| Fig 4.
Dilutional sensitivity of anti-inv16 antibody versus
RT-PCR for detection of type A fusion. (A) Dilutional sensitivity of anti-inv16 Ab. PN 19 AML cells were serially diluted into normal bone
marrow cells and analyzed by flow cytometry. The black trace represents
isotype control. The gray trace represents anti-inv(16) Ab. (A)
Undiluted PN 19 AML cells; (b and C) Cell dilutions shown to level of
undetectable fluorescence shift (1:20). The D-values for results in
(A), (B), and (C) are 0.71, 0.58, and 0.06, respectively. (B)
Single-round RT-PCR of PN 19 AML sample [inv(16)+ with type A
fusion] and serial normal bone marrow dilutions, using primers C1 and
M1. PCR products were hybridized with a type A junction specific
oligonucleotide probe. Lanes 1 through 6, undiluted PN 19 sample, 1:10
dilution, 1:20 dilution, 1:100 dilution, 1:103
dilution., and 1:104 dilution, respectively;
lane 7, pure normal marrow; lane 8, negative control (no RNA).
|
|
 |
DISCUSSION |
The importance of defining the molecular pathology of leukemic subtypes
for rapid diagnosis, stratification, prognostication, and, more
fundamentally, delineating unique biologic features is being
increasingly recognized. From the diagnostic standpoint, identification
of particular leukemic entities should be rapid, sensitive, and
reproducible. The inv(16) and related t(16;16) cytogenetic
abnormalities occur in approximately 10% of de novo AML and are highly
associated with FAB AML-M4Eo subtype. However, as demonstrated by this
and previous studies,9,16,17,21,22,34,35 these cytogenetic
findings may be associated with several other FAB AML types, with or
without abnormal eosinophils, and the pathologic-cytogenetic correlation would appear to be somewhat dependent on the case selection
bias in various studies. In addition, these karyotypic events may be
subtle and difficult to discern at the cytogenetic level of
resolution.36
Molecular analysis of the CBFB-MYH11 fusion is a specific
method for diagnosis and potential monitoring of inv(16)/t(16;16) AML.
Several techniques have been described for identification of this
genetic anomaly, including FISH,13,21,37 Southern hybridization analysis for CBFB or MYH11
rearrangements,13,32,38,39 and, most commonly,
RT-PCR.13,16-22 The latter methodology is relatively rapid
and can be used for residual disease assessment due to the enhanced
sensitivity of PCR. However, the requirements for high-quality RNA,
multiple procedural steps, and the possibility of sample contamination
currently remain the most important shortcomings of this technique.
Additionally, RT-PCR approaches must be capable of detecting the
numerous CBFB-MYH11 fusion variants. Immunologic methods of
detection have the potential advantages of rapidity, relative technical
ease, and the ability to use smaller numbers of viable cells.
The type A CBF -SMMHC fusion protein has previously been studied in a
small number of inv(16) AML cases by Western blot analysis and indirect
immunofluorescence using anti-inv16 Ab.26 More recent
evidence has convincingly demonstrated cytoplasmic distribution of the
CBF -SMMHC protein in transfected cells with this
antibody.40 We have also performed indirect
immunofluorescence experiments on a limited number of primary inv(16)
AML samples using anti-inv16 Ab, confirming cytoplasmic localization of
the CBF -SMMHC protein (data not shown). These studies thus suggest
that one mechanism by which the CBF -SMMHC protein may act in a
dominant negative fashion is by sequestration of AML1 (CBF ) protein
within the cytoplasm.
This is the first report to examine the use of this polyclonal antibody
as an investigational and potentially a diagnostic tool in a larger
group of AML samples. The method presented here allows for rapid
fixation and permeabilization of cells to detect the CBF -SMMHC
protein and simultaneously assess surface markers, such as CD34.
Although cell permeabilization techniques are often used in
experimental situations requiring characterization of intracellular
molecules, this study further demonstrates the potential for using
novel antibodies to detect specific intracytoplasmic or intranuclear
leukemic fusion proteins in a relatively routine flow phenotyping
setting. An excellent detection rate and specificity were observed
using anti-inv16 Ab in our study group of leukemic patients. Of 23 cytogenetically confirmed inv(16)/t(16;16) AML cases, flow cytometric
detection of the CBF -SMMHC protein was positive in all. Accordingly,
no positive results were observed within the group of 18 control
leukemias and normal peripheral blood and bone marrow specimens.
Furthermore, although anti-inv16 Ab was raised against the type A
common CBF -SMMHC fusion protein (junctional sequence epitope), the
antibody proved capable of detecting one each of type C and type D
fusions present within the group of positive cases. This antibody has
been previously reported to be nonreactive with either endogenous
CBF or SMMHC proteins.26 These foregoing observations
suggest that this polyclonal rabbit antibody is capable of identifying
multiple CBF -SMMHC fusion types, including apparently rare novel
inv(16)/t(16;16) events. In part, this broader spectrum of specificity
may be related to a combination of shared epitope recognition [ie, the
relative invariability of the CBF fusion site in most
inv(16)/t(16;16) AML] and some degree of cross-affinity for the
repetitive coiled-coil regions of the variable SMMHC tail segments in
the different fusions. In support of this latter concept is the finding
that anti-inv16 Ab was also capable of recognizing a novel CBF -SMMHC
fusion in a case of t(16;16) AML (PN 22, Table 1). RT-PCR and
sequence analysis of the PCR product in this case showed a previously
undescribed CBFB-MYH11 transcript, with fusion sites at
CBFB nt 455 and MYH11 nt 1893. This fusion is predicted
to result in an in-frame CBFB-MYH11 mRNA, differing in size
from the type A fusion transcript by a deletion of 12 nt. Examination
of the reported CBFB13 and MYH11 (K. Okajima, unpublished findings, GenBank Accession No.
X69292, 1992) cDNA sequences did not show the presence of classical
flanking donor and acceptor splice sites, respectively; thus, the
mechanism underlying the generation of this fusion type is presently
unclear.
RT-PCR analysis for minimal residual disease (MRD) assessment in
inv(16)/t(16;16) AML has been previously
described,18,19,21,22 with relatively short median
follow-up intervals and somewhat inconclusive results. Two recent
reports have suggested that the semiquantitative assessment of
CBFB-MYH11 transcript after standard induction chemotherapy may
be correlated with outcome and relapse risk
post-therapy.41,42 In the present study, the dilutional sensitivity of anti-inv16 Ab in detecting the CBF -SMMHC protein was
determined to be in the range of only 1:5 to 1:10 leukemic cells to normal cells, in comparison to RT-PCR technique, which consistently detects chimeric CBFB-MYH11 type A fusion events at the level of at least 1 in 104
cells.19,21,22,41 The flow cytometric findings obtained here may reflect differences in the relative capability of identifying intracellular targets, as opposed to more accessible surface molecules, the need for cell permeabilization, and a potentially low antibody affinity. Thus, the use of this antibody for monitoring posttherapeutic at risk patients at an appropriately sensitive predictive level does
not appear to be practical, as evaluated with the current protocol.
However, because the specificity and localization of anti-inv16 Ab has
been previously established26,40 and corroborated in this
study, these results should provide the impetus for development of a
high-quality monoclonal antibody.
In summary, we have demonstrated the flow cytometric use of an
antibody, anti-inv16 Ab, that recognizes the common type A CBF -SMMHC
leukemic fusion protein and apparently rarer fusion types occurring in
inv(16)/t(16;16) myeloid leukemia. In addition, we describe a
previously unreported CBFB-MYH11 chimeric transcript with
unique fusion sites at the mRNA level in both genes. The method
described here is rapid, and the use of this antibody should enhance
investigational efforts and, potentially, clinical diagnosis in
inv(16)/t(16;16) AML.
 |
FOOTNOTES |
Submitted October 9, 1997;
accepted December 22, 1997.
M.L.S., C.R., D.R.H., and C.L.W. are members of the Southwest Oncology
Group Leukemia Biology and Cytogenetics Programs, San Antonio, TX.
D.S.V. was a Fellow of the R. Samuel McLaughlin Foundation of Canada
during the course of this work. P.P.L. is a Special Fellow of the
Leukemia Society of America. Supported by Department of Health and
Human Services National Institutes of Health Grant No. U01 CA32102
supporting the SWOG Leukemia, Leukemia Biology and Cytogenetics
Programs.
Address correspondence to Cheryl L. Willman, MD, University of New
Mexico Cancer Center, 900 Camino de Salud NE, Albuquerque, NM 87131. Address reprint requests to SWOG Operations Office, 14908 Omicron Dr,
San Antonio, TX 78245-3217.
The publication costs of this article were defrayed in part by
page charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section
1734 solely to indicate this fact.
 |
REFERENCES |
1.
Arthur DC,
Bloomfield CD:
Partial deletion of the long arm of chromosome 16 and bone marrow eosinophilia in acute nonlymphocytic leukemia: A new association.
Blood
61:994,
1983[Abstract/Free Full Text]
2.
le Beau MM,
Larson RA,
Bitter MA,
Vardiman JW,
Golomb HM,
Rowley JD:
Association of an inversion of chromosome 16 with abnormal marrow eosinophils in acute myelomonocytic leukemia.
N Engl J Med
309:630,
1983[Abstract]
3.
de la Chapelle A,
Lahtinen R:
Chromosome 16 and bone marrow eosinophilia.
N Engl J Med
309:1394,
1983[Medline]
[Order article via Infotrieve]
4.
Hogge DE,
Misawa S,
Parsa NZ,
Pollak A,
Testa JR:
Abnormalities of chromosome 16 in association with acute myelomonocytic leukemia and dysplastic bone marrow eosinophils.
J Clin Oncol
6:550,
1984
5.
Tantravahi R,
Schwenn M,
Henkle C,
Nell M,
Leavitt PR,
Griffin JD,
Weinstein HJ:
A pericentric inversion of chromosome 16 is associated with dysplastic marrow eosinophils in acute myelomonocytic leukemia.
Blood
63:800,
1984[Abstract/Free Full Text]
6.
Bitter MA,
le Beau MM,
Larson RA,
Rosner MC,
Golomb HM,
Rowley JD,
Vardiman JW:
A morphologic and cytochemical study of acute myelomonocytic leukemia with abnormal marrow eosinophils associated with inv(16)(p13;q22).
Am J Clin Pathol
81:733,
1984[Medline]
[Order article via Infotrieve]
7.
Bennett JM,
Catovsky D,
Daniel M-T,
Landrin G,
Galton DAG,
Gralnick HR,
Sultan C:
Proposed revised criteria for the classification of acute myeloid leukemia. A report of the French-American-British cooperative group.
Ann Intern Med
103:626,
1985
8.
Larson RA,
Williams SF,
Le Beau MM,
Bitter MA,
Vardiman JW,
Rowley JD:
Acute myelomonocytic leukemia with abnormal eosinophils and inv(16) or t(16;16) has a favorable prognosis.
Blood
68:1242,
1986[Abstract/Free Full Text]
9.
Campbell L,
Challis J,
Fok T,
Garson OM:
Chromosome 16 abnormalities associated with myeloid malignancies.
Genes Chromosom Cancer
3:55,
1991[Medline]
[Order article via Infotrieve]
10.
Betts DR,
Rohatiner AZS,
Evans ML,
Rassam SMB,
Lister TA,
Gibbons B:
Abnormalities of chromosome 16q in myeloid malignancy: 14 new cases and a review of the literature.
Leukemia
6:1250,
1992[Medline]
[Order article via Infotrieve]
11.
Haferlach T,
Gassman W,
Loffler H,
Jurgensen C,
Noak J,
Ludwig W-D,
Thiel E,
Haase D,
Fonatsch C,
Becher R,
Schlegelberger B,
Nowrousian MR,
Lengfelder E,
Eimermacher H,
Weh HJ,
Braumann D,
Maschmeyer G,
Koch P,
Heinecke A,
Sauerland MC,
Buchner T,
for the AML Cooperative Group:
Clinical aspects of acute myeloid leukemias of the FAB types M3 and M4Eo.
Ann Hematol
66:165,
1993[Medline]
[Order article via Infotrieve]
12.
Dastugue N,
Payen C,
Lafage-Pochitaloff M,
Bernard P,
Leroux D,
Huguet-Rigal F,
Stoppa A-M,
Marit G,
Molina L,
Michallet M,
Maraninchi D,
Attal M,
Reiffers J:
Prognostic significance of karyotype in de novo adult acute myeloid leukemia.
Leukemia
9:1491,
1995[Medline]
[Order article via Infotrieve]
13.
Liu P,
Tarle SA,
Hajra A,
Claxton DF,
Marlton P,
Freedman M,
Siciliano MJ,
Collins FS:
Fusion between transcription factor CBF /PEBP2 and a myosin heavy chain in acute myeloid leukemia.
Science
261:1041,
1993[Abstract/Free Full Text]
14.
Liu PP,
Hajra A,
Wijmenga C,
Collins FS:
Molecular pathogenesis of the chromosome 16 inversion in the M4Eo subtype of acute myeloid leukemia.
Blood
85:2289,
1995[Free Full Text]
15.
Castilla LH,
Wijmenga C,
Wang Q,
Stacy T,
Speck NA,
Eckhaus M,
Marin-Padilla M,
Collins FS,
Wynshaw-Boris A,
Liu PP:
Failure of embryonic hematopoiesis and lethal hemorrhages in mouse embryos heterozygous for a knocked-in gene CBFB-MYH11.
Cell
87:687,
1996[Medline]
[Order article via Infotrieve]
16.
Shurtleff SA,
Meyers S,
Hiebert SW,
Raimondi SC,
Head DR,
Willman CL,
Wolman S,
Slovak ML,
Carroll AJ,
Behm F,
Hulshof MG,
Motroni TA,
Okuda T,
Liu P,
Collins FS,
Downing JR:
Heterogeneity in CBFb/MYH11 fusion messages encoded by the inv(16)(p13q22) and the t(16;16)(p13;q22) in acute myelogenous leukemia.
Blood
85:3695,
1995[Abstract/Free Full Text]
17.
Costello R,
Sainty D,
Lecine P,
Cusenier A,
Mozziconacci M-J,
Arnoulet C,
Maraninchi D,
Gastaut J-A,
Imbert J,
Lafage-Pochitaloff M,
Gabert J:
Detection of CBF /MYH11 fusion transcripts in acute myeloid leukemia: Heterogeneity of cytological and molecular characteristics.
Leukemia
11:644,
1997[Medline]
[Order article via Infotrieve]
18.
Claxton DF,
Liu P,
Hsu HB,
Marlton P,
Hester J,
Collins F,
Deisseroth AB,
Rowley JD,
Siciliano MJ:
Detection of fusion transcripts generated by the inversion 16 chromosome in acute myelogenous leukemia.
Blood
83:1750,
1994[Abstract/Free Full Text]
19.
Hebert J,
Cayuela J-M,
Daniel M-T,
Berger R,
Sigaux F:
Detection of minimal residual disease in acute myelomonocytic leukemia with abnormal eosinophils by nested polymerase chain reaction with allele specific amplification.
Blood
84:2291,
1994[Abstract/Free Full Text]
20.
van der Reijden BA,
Lombardo M,
Dauwerse HG,
Giles RH,
Muhlematter D,
Jotterand Bellomo M,
Wessels HW,
Beverstock GC,
van Ommen GJB,
Hagemeijer A,
Breuning MH:
RT-PCR diagnosis of patients with acute nonlymphocytic leukemia and inv(16)(p13q22) and identification of new alternative splicing in CBFB-MYH11 transcripts.
Blood
86:277,
1995[Abstract/Free Full Text]
21.
Poirel H,
Radford-Weiss I,
Rack K,
Troussard X,
Veil A,
Valensi F,
Picard F,
Guesnu M,
Leboeuf D,
Melle J,
Dreyfus F,
Flandrin G,
Macintyre E:
Detection of the chromosome 16 CBF -MYH11 fusion transcript in myelomonocytic leukemias.
Blood
85:1313,
1995[Abstract/Free Full Text]
22.
Tobal K,
Johnson PRE,
Saunders MJ,
Harrison CJ,
Liu Yin JA:
Detection of CBFB/MYH11 transcripts in patients with inversion and other abnormalities of chromosome 16 at presentation and remission.
Br J Haematol
91:104,
1995[Medline]
[Order article via Infotrieve]
23.
Sang B-C,
Shi L,
Dias P,
Liu L,
Wei J,
Wang Z-X,
Monell CR,
Behm F,
Gruenwald S:
Monoclonal antibodies specific to the acute lymphoblastic leukemia t(1;19)-associated E2A/pbx1 chimeric protein: Characterization and diagnostic utility.
Blood
89:2909,
1997[Abstract/Free Full Text]
24.
Dyck JA,
Warrell RP Jr,
Evans RM,
Miller WH Jr:
Rapid diagnosis of acute promyelocytic leukemia by immunohistochemical localization of PML/RAR protein.
Blood
86:862,
1995[Abstract/Free Full Text]
25.
Claxton D,
Xie Q-S,
Patel S,
Deisseroth AB,
Kornblau S:
The gene product of CBFB-MYH11.
Leukemia
10:1479,
1996[Medline]
[Order article via Infotrieve]
26.
Liu PP,
Wijmenga C,
Hajra A,
Blake TB,
Kelley CA,
Adelstein RS,
Bagg A,
Rector J,
Cotelingam J,
Willman CL,
Collins FS:
Identification of the chimeric protein product of the CBFB-MYH11 fusion gene in inv(16) leukemia cells.
Genes Chromosom Cancer
16:77,
1996[Medline]
[Order article via Infotrieve]
27.
Weick JK,
Kopecky KJ,
Appelbaum FR,
Head DR,
Kingsbury LL,
Balcerzak SP,
Bickers JN,
Hynes HE,
Welborn JL,
Simon SR,
Grever M:
A randomized investigation of high-dose versus standard-dose cytosine arabinoside with daunorubicin in patients with previously untreated acute myeloid leukemia.
Blood
88:2841,
1995[Abstract/Free Full Text]
28. Godwin J, Kopecky KJ, Head DR, Leith CP, Willman CL, Hynes HE,
Balcerzak SP, Appelbaum FR: A double blind placebo controlled trial of
G-CSF in elderly patients with previously untreated acute myeloid
leukemia. A Southwest Oncology Group study (9031). Blood (in
press)
29.
Tallman MS,
Andersen JW,
Schiffer CA,
Appelbaum FR,
Feusner JH,
Ogden A,
Sheperd L,
Willman C,
Bloomfield CD,
Rowe JM,
Wiernik PH:
All-trans retinoic acid in acute promyelocytic leukemia.
N Engl J Med
337:1021,
1997[Abstract/Free Full Text]
30.
Leith CP,
Kopecky KJ,
Godwin J,
McConnell T,
Slovak ML,
Chen I-M,
Head DR,
Appelbaum FR,
Willman CL:
Acute myeloid leukemia in the elderly: Assessment of multidrug resistance (MDR1) and cytogenetics distinguishes biologic subgroups with remarkably distinct responses to standard chemotherapy. A Southwest Oncology Group study. |