| |
|
|
|
|
|
|
|||
|
By
From the Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York; the Laboratory of Immunogenetics, The New York Blood Center, New York; and the Department of Medicine, the Division of Hematology, Mount Sinai School of Medicine, New York, NY.
The purposes of the research reported here were first to explore a murine model for human placental and umbilical cord blood transplantation and second to evaluate the engraftment ability of ex vivo cultured hematopoietic cells. Murine near-term fetal and neonatal peripheral blood (FNPB) cells, genetically marked with the human multiple drug resistance transgene (MDR1) were used for syngeneic transplants into sublethally irradiated adult mice. Donor cells were transplanted either fresh and untreated, or after ex vivo culture in the presence of the hematopoietic growth factors recombinant murine stem cell factor, recombinant human interleukin-3 (rHu IL-3), and rHu IL-6, in a liquid culture system. To evaluate, count, and characterize FNPB progenitor cell-derived colonies, neonatal mouse mononuclear cells were cultured directly in methylcellulose with growth factors. To assess their ex vivo expansion ability, FNPB mononuclear cells were first cultured in liquid medium for 3 to 8 days and then transferred to semisolid assay plates. Evaluation of the cell counts after liquid culture showed a 1.4- to 11.6-fold increase, and the numbers of colonies observed in methylcellulose were similar to those produced by fresh FNPB cells. Donor-type engraftment was demonstrated by polymerase chain reaction (PCR) amplification of the human MDR1 transgene in the peripheral blood of all surviving animals (5 of 7 recipients of the fresh, and 3 of 8 recipients of the ex vivo-cultured cells) 2 to 4 months after transplantation. The proportion of donor leukocytes in the peripheral blood of the recipients (chimerism) was evaluated using fluorescence in situ hybridization (FISH) analysis 4 to 6 months after transplantation and ranged from 2% to 26%. In addition, bone marrow cultures were obtained from two recipient animals: one had received fresh-untreated cells and was evaluated 8 months after transplant, the other had received ex vivo cultured cells and was tested 14 months after grafting. The derived hematopoietic colonies were tested by PCR and the transgene was detected, conclusively proving long-term engraftment of donor cells. These results indicate that FNPB transplants can be successfully performed in sublethally irradiated mice with and without ex vivo culture. Long-term donor-type engraftment with sustained chimerism has been demonstrated. Thus, murine neonatal blood grafts can be used as an animal model for cord blood transplantation for gene therapy studies where complete myeloablation is not desirable and partial replacement of defective marrow may be sufficient. Furthermore, the possibility of numerically expanding hematopoietic progenitor cells contained in neonatal blood without affecting their engraftment ability could facilitate use of cord blood grafts in adult recipients.
HUMAN PLACENTAL/UMBILICAL cord blood (PCB), as a source of hematopoietic progenitor cells for bone marrow (BM) reconstitution, has been shown to yield successful transplants from siblings,1,2 and more recently, from unrelated donors.3,4 In comparison with BM, the collection of PCB is easier and the transmission of certain infectious agents, particularly cytomegalovirus, to recipients, is much less common.5 Most importantly, PCB grafts may result in decreased incidence of graft-versus-host disease (GVHD), even in partially mismatched cases.3,4 Some of us are currently involved in a study evaluating the feasibility of large-scale use of PCB for unrelated donor transplantation.6 While diverse aspects of the clinical use of PCB are being investigated, research in animals could accelerate progress in this field. For example, it is important to determine whether it is the lower alloresponsiveness of PCB cells that allows major histocompatibility complex (MHC)-disparate transplants to engraft without excessive GVHD and, if so, to define the level of MHC-incompatibility that may be tolerated. Similarly, given the higher rates of gene transfer into these cells,7 genetic engineering of PCB-derived stem cells is being actively pursued, and an animal model would facilitate testing and accelerate the definition of optimal experimental conditions. Murine and rat models for several genetic diseases (severe combined immune deficiency, thalassemia, mucopolysaccharidoses) are available, which would allow a more rapid evaluation of gene therapy with transduced fetal and neonatal blood stem cells.
The mouse is probably the most thoroughly explored model: it has been used in studies of the immunogenetics of soft tissue and bone marrow transplantation (BMT) for several decades. Preparative radiation regimens, BM cell doses, posttransplant recovery, and clinical characteristics of GVHD are all well established. Relatively simple hematopoietic stem/progenitor cell assays of murine BM-derived colonies in semisolid media are widely available8,9 and short-term suspension cultures of BM cells in the presence of hematopoietic growth factors have been recently shown to expand the committed progenitor cell population. The combination of c-kit, interleukin-3 (IL-3), and IL-6 in these cultures resulted in the greatest expansion, as measured by transplantation results: while 105 ex vivo expanded adult BM cells achieved radioprotection, no less than 106 unmodified cells were needed for BM restoration of lethally irradiated animals.10,11 Accelerated recovery of peripheral blood cell counts was observed with the ex vivo expanded donor cells, and their long-term repopulating ability appeared to be preserved in serial transplantation studies.11
The goal of our study was to develop a murine transplantation model with particular applications to the treatment of genetic diseases. We report that murine fetal and neonatal peripheral blood (FNPB) cells engraft when transplanted into sublethally irradiated adult recipients and lead to stable, long-term chimerism. Using the mouse as a model for human PCB transplantation, appears warranted for conditions in which partial BM replacement may suffice.
Syngeneic Transplants of FNPB Cells Into Adult Mice
Hematopoietic Progenitor Cell Assays of FNPB Cells
Analysis of Transplanted Mice Polymerase chain reaction (PCR) amplification of peripheral blood leukocytes. All animals were tested at least 60 days after transplantation (range, 62 to 134 days). Peripheral blood (50 to 75 µL) was collected from the sectioned lateral veins of the tail of each recipient into microcapillary tubes. Buffy coats (2.5 to 7.5 × 105 leukocytes) were dispersed into 100 µL of DNA extraction buffer: 50 mmol/L KCl, 10 mmol/L Tris HCl pH 8.0, 2.2 mmol/L MgCl2 , 0.1 mg/mL gelatin, 0.45% Nonidet P40, 0.45% Tween 20, and 10 µg proteinase K for 2 hours at 55°C. DNA isolation was performed by sequential phenol/chloroform extraction and ethanol precipitation. DNA concentration was estimated with a commercial kit (DNA DipStick; Invitrogen, San Diego, CA). Transgene detection was accomplished by PCR amplification of DNA with primers specific for the human MDR1 cDNA: sense primer (residues 2596 to 2615), 5' CCATCATTGCAATAGCAGG 3', and antisense primer (residues 2733 to 2752), 5' GTTCAAACTTCTGCTCCTGC 3'.17 PCR amplification of approximately 100 ng of template DNA was performed using Perkin-Elmer's PCR kit (Perkin-Elmer, Branchburg, NJ) following manufacturer's instructions. Final concentrations in the reaction were: 100 pmol/L specific primers, 2.5 mmol/L MgCl2 , 200 µmol/L dNTPs, 1× PCR buffer, and 2.5 U Taq DNA polymerase. The final volume of the PCR reaction was adjusted to 100 µL. PCR was performed for 40 cycles: 95°C × 5 minutes, then 94°C × 1 minute, 60°C × 1 minute, and 72°C × 2 minutes in a Perkin-Elmer thermal cycler. Reactions were set up using aerosol-proof tips and standard PCR precautions to avoid cross-contamination.18 Seventy microliters of the PCR products were subjected to gel electrophoresis in 1.8% agarose containing 0.5 ng/mL ethidium bromide to allow visualization of the amplified products and transferred to nylon membranes. Southern blots were hybridized with a 32P-labeled human MDR cDNA probe,14 washed and incubated with an autoradiographic plate overnight. Positive controls were obtained by appropriate dilution of transgenic placental DNA; negative controls were from normal mouse spleen DNA. Molecular sizes were estimated from a commercial 100-bp ladder (GIBCO).Fluorescence In Situ Hybridization (FISH) Analysis of Peripheral Blood Leukocyte At 129 to 196 days after transplantation, 50 to 100 µL of peripheral blood was collected from the transplant recipients. The buffy coat was separated, cytospin preparations were made, and the slides were processed according to previously published FISH methods,19,20 modified as follows. Red blood cells were lysed in 1:1 (vol/vol) acetic acid: methanol, for 4 minutes and fixed in 1:3 (vol/vol) acetic acid: methanol. After dehydration in 75%, 80%, and 100% ethanol, the DNA on the slides was denatured in 70% Formamide/2x SSC for 5 minutes at 75°C. A full-length human MDR1 cDNA probe was labeled by nick translation with deoxyuridine triphosphate (dUTP)-digoxigenin (Boehringer Mannheim, Indianapolis, IN). The probe (20 ng/µL) was diluted in Hybrisol VI (Oncor, Gaitherburg, MD) and the mixture was denatured for 5 minutes at 70°C. Approximately 100 ng of the probe mixture were placed on each slide and in situ hybridization was performed for 16 hours at 37°C. The signal was detected using a fluorescein isothiocyanate (FITC) conjugated antidigoxigenin antibody (Boehringer Mannheim). Interphase nuclei were counter-stained with 0.2 ng/µL DAPI (Sigma) for 5 minutes. Between 130 and 500 cells from each animal were scored and images of positive cells were generated with a Cytovision System (Applied Imaging, Pittsburgh, PA).PCR Analysis of BM-Derived Colonies BM-derived colonies from two long-term transplant survivors were evaluated for the presence of the transgene. The first animal, recipient of fresh, untreated cells was tested 8 months after transplant, the other had received cells after ex vivo culture and was evaluated 14 months after transplant.
Hematopoietic Progenitor Cell Assays of FNPB Cells Methylcellulose cultures. Progenitor cell-derived colonies were present in methylcellulose cultures of FNPB mononuclear cells. The days of peak colony growth and the numbers of colonies (mean ± standard deviation [SD], range) are summarized in Table 1. Representative burst-forming unit-erythroid (BFU-E) and colony-forming unit-granulocyte-macrophage (CFU-GM) colonies are shown in Fig 1A and B. It is of particular interest that between days 19 and 45, a small number (1 to 3/105 cells plated) of large colonies with poorly differentiated cells were observed, as seen in Fig 1C. In two experiments, these large colonies were removed from the methylcellulose cultures, the cells were dispersed and replated in fresh methylcellulose cultures. Secondary colonies developed (data not shown). Therefore, these colonies appear to be primitive multipotential progenitor cells, perhaps analogous to the high proliferative potential colony forming cells (HPP-CFC).
Transplantation Studies
The work presented here demonstrates that syngeneic FNPB cells can engraft in sublethally irradiated adult recipients and that chimerism persists for several months after transplantation. Therefore, long-term survival of the graft can be achieved without complete myeloablation.
Submitted July 24, 1996;
accepted September 5, 1996.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hearly marked
``advertisment'' in accordance with 18 U.S.C. section 1734 solely to
indicate this fact. We thank Dr Julie Asch, Dr Lisa Mueller, Michelle Geller, and Lily Kiang for their superb technical assistance. We thank Dr Richard Rosenfield for stimulating discussions and advice.
1.
Broxmeyer HE,
Douglas GW,
Hangoc C,
Cooper S,
Bard J,
English D,
Arny M,
Thomas L,
Boyse EA:
Human umbilical cord blood as a potential source of transplantable hematopoietic stem/progenitor cells.
Proc Natl Acad Sci USA
86:3828,
1989
2. Wagner JE, Kernan NA, Broxmeyer HE, Gluckman E: Transplantation of umbilical cord blood in 50 patients: Analysis of the Registry data. Blood 84:395a, 1994 (abstr, suppl 1)
3.
Kurtzberg J,
Graham M,
Casey J,
Olson J,
Stevens C,
Rubinstein P:
The use of umbilical cord blood in mismatched related and unrelated hemopoietic stem cell transplantation.
Blood Cells
20:275,
1994[Medline]
[Order article via Infotrieve]
4. Kurtzberg J, Laughlin M, Smith C, Olsen J, Graham ML, Stevens C, Rubinstein P: Umbilical cord blood: An alternative source of hematopoietic stem cells for bone marrow reconstitution in unrelated donor transplantation. Blood 86:290a, 1995 (abstr, suppl 1)
5.
Rubinstein P,
Rosenfield RE,
Adamson JW,
Stevens CE:
Stored placental blood for unrelated bone marrow reconstitution.
Blood
81:1679,
1993
6.
Rubinstein P,
Taylor PE,
Scaradavou A,
Adamson JW,
Migliaccio G,
Emmanuel D,
Berkowitz RL,
Alvarez E,
Stevens CE:
Unrelated placental blood for bone marrow reconstitution: Organization of the Placental Blood Project.
Blood Cells
20:587,
1994[Medline]
[Order article via Infotrieve]
7.
Lu L,
Xiao M,
Clapp DW,
Li Z-H,
Broxmeyer HE:
High efficiency retroviral mediated gene transduction into single isolated immature and replatable CD343+ hematopoietic stem/progenitor cells for human umbilical cord blood.
J Exp Med
178:2089,
1988
8.
Iscove NM,
Sieber F,
Winterhalter KH:
Erythroid colony formation in cultures of mouse and human bone marrow: Analysis of the requirement for erythropoietin by gel filtration and affinity chromatography on agarose-conconavalin A.
J Cell Physiol
83:309,
1974[Medline]
[Order article via Infotrieve]
9.
McLeod DL,
Shreive MM,
Axelrad AA:
Improved plasma culture system for production of erythrocytic colonies in vitro: Quantative assay method for CFU-E.
Blood
44:515,
1974
10.
Muench MO,
Moore MAS:
Accelerated recovery of peripheral blood cell counts in mice transplanted with in vitro cytokine-expanded hematopoietic progenitors.
Exp Hematol
20:611,
1992[Medline]
[Order article via Infotrieve]
11.
Muench MO,
Firpo MT,
Moore MAS:
Bone marrow transplantation with interleukin-1 plus kit-ligand ex vivo expanded bone marrow accelerates hematopoietic reconstitution in mice without the loss of stem cell lineage and proliferative potential.
Blood
81:3463,
1993
12.
Roninson IB,
Chin JE,
Choi K,
Gros P,
Housman DE,
Fojo A,
Shen D-W,
Gottesman MM,
Pastan I:
Isolation of human mdr DNA sequences amplified in multidrug resistant KB carcinoma cells.
Proc Natl Acad Sci USA
83:4538,
1986
13. Isola L, Frank S, Cagnoni P, Gordon J: Cardiotoxicity of adriamycin in multidrug resistant mice. Blood 80:1744a, 1992 (abstr)
14.
Gordon JW,
Scangos GA,
Plotkin DJ,
Barbosa JA,
Ruddle FH:
Genetic transformation of mouse embryos by microinjection of purified DNA.
Proc Natl Acad Sci USA
77:7380,
1980
15.
Weinberg RS,
Thomson JC,
Lao R,
Chen G,
Alter BP:
Stem cell factor amplifies newborn and sickle erythropoiesis in liquid cultures.
Blood
81:2591,
1993
16.
Weinberg RS,
Golberg JD,
Scofild JM,
Lenes AL,
Styczynski R,
Alter BP:
Switch from fetal to adult hemoglobin is associated with a change in progenitor cell population.
J Clin Invest
7:785,
1983
17.
Noonan KE,
Beck C,
Holtmayer TA,
Chin JE,
Wunder JS,
Andrulis IL,
Gadzar AF,
William CL,
Griffith B,
Von Hoff DD,
Roninson IB:
Quantative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction.
Proc Natl Acad Sci USA
87:7160,
1990
18.
Bradbury M,
Isola L,
Gordon J:
Enzymatic amplification of a repeated DNA sequence from the mouse Y chromosome allows the determination of sex in a single blastomere.
Proc Natl Acad Sci USA
87:4053,
1990
19.
Najfeld V,
Ballard SG,
Menninger J,
Ward DC,
Bouhassira EE,
Schwartz RS,
Nagel RL,
Rybicki AC:
The gene for human erythrocyte protein 4.2 maps to chromosome 15q15.
Am J Hum Genet
50:71,
1992[Medline]
[Order article via Infotrieve]
20.
Najfeld V,
Menninger J,
Ballard SG,
Dequchi Y,
Ward DC,
Kehrl JH:
Two diverged human homeobox genes involved in the differentiation of human hematopoietic progenitors map to chromosome 1q41-q42.1.
Genes Chromosom Cancer
5:343,
1992[Medline]
[Order article via Infotrieve]
21.
Broxmeyer HE,
Kurtzberg J,
Gluckman E,
Auerbach AD,
Douglas G,
Cooper S,
Falkenburg JHF,
Bard J,
Boyse EA:
Umbilical cord blood hematopoietic stem and repopulating cells in human clinical transplantation.
Blood Cells
17:313,
1991[Medline]
[Order article via Infotrieve]
22.
La Salle V,
Gluckman E,
Bruley-Rosset M:
Newborn blood can engraft adult mice without inducing graft-versus-host disease across non-H2 antigens.
Blood
87:3977,
1996
23.
Barker JE:
Embryonic mouse peripheral blood colony-forming units.
Nature
228:1305,
1970[Medline]
[Order article via Infotrieve]
24.
Carow CE,
Hangoc G,
Broxmeyer HE:
Human multipotential progenitor cells (CFU-GEMM) have extensive replating capacity for secondary CFU-GEMM: An effect enhanced by cord blood plasma.
Blood
81:942,
1993
25.
Lu L,
Xiao M,
Shen R-N,
Grigsby S,
Broxmeyer HE:
Enrichment, characterization and responsiveness of single primitive CD34+ human umbilical cord blood hematopoietic progenitors with high proliferative and replating potential.
Blood
81:41,
1993
26.
Muench M,
Schneider JG,
Moore MAS:
Interactions among colony stimulating factors, IL-1b, IL-6 and kit-ligand in the regulation of primitive murine hematopoietic cells.
Exp Hematol
20:339,
1992[Medline]
[Order article via Infotrieve]
27.
Moore MAS,
Hoskin I:
Ex vivo expansion of cord blood-derived stem cells and progenitors.
Blood Cells
20:468,
1994[Medline]
[Order article via Infotrieve]
28.
Migliaccio AR,
Migliaccio G,
Adamson JW:
Expansion of human neonatal progenitor cells in vitro under serum-deprived conditions.
Blood Cells
20:424,
1994[Medline]
[Order article via Infotrieve]
29.
Van Epps DE,
Bendin J,
Lee W,
Schilling W,
Smith A,
Smith S,
Unverzagt K,
Law P,
Burgers J:
Harvesting, characterization and culture of CD34+ cells from human bone marrow, peripheral blood and cord blood.
Blood Cells
20:411,
1994[Medline]
[Order article via Infotrieve]
30.
Ruggieri L,
Heimfeld S,
Broxmeyer HE:
Cytokine-dependent ex vivo expansion of early subsets of CD34+ cord blood myeloid progenitors is enhanced by cord blood plasma, but expansion of more mature subsets of progenitors is favored.
Blood Cells
20:436,
1994[Medline]
[Order article via Infotrieve]
31.
Peters SO,
Kittler ELW,
Ramshaw HS,
Quesenberry PJ:
Ex vivo expansion of murine marrow cells with interleukin-3 (IL-3), IL-6, IL-11 and stem cell factor leads to impaired engraftment in irradiated hosts.
Blood
87:30,
1996
32. Blaese RM: Development of gene therapy for immunodeficiency: Adenosine deaminase deficiency. Pediatr Res 33:S42, 1993 (suppl 1)
33.
Moritz T,
Keller DC,
Williams DA:
Human cord blood cells as targets for gene transfer: Potential use in genetic therapies of severe combined immunodeficiency disease.
J Exp Med
178:529,
1993
34.
Harrison DE:
Competitive repopulation in unirradiated normal recipients.
Blood
81:2473,
1993
35.
Stewart FM,
Crittenden RB,
Lowry PA,
Pearson-White S,
Quesenberry PJ:
Long-term engraftment of normal and post 5-fluorouracil murine marrow into normal nonmyeloablated mice.
Blood
81:2566,
1993
36.
Barker JE,
Compton ST:
Hematopoietic repopulation of adult mice with
37.
Blau CA,
Stamatoyannopoulos G:
Preemptive therapy for genetic disease.
Nature Medicine
2:161,
1996[Medline]
[Order article via Infotrieve]
38.
Luskey BD,
Rosenblatt M,
Zsebo K,
Williams DA:
Stem cell factor, IL-3 and IL-6 promote retroviral-mediated gene transfer into murine hematopoietic stem cells.
Blood
80:396,
1992 | |||||||||||