| |
|
|
|
|
|
|
|||
|
By
From the Department of Pathology, University of Southern California School of Medicine, Los Angeles; the Division of Hematology-Oncology, the Department of Medicine, UCLA School of Medicine, Los Angeles, CA; and the Section of Pediatric Hematology-Oncology, Mayo Clinic, Rochester, MN.
Although monoclonal antibody (MoAb) therapy of the human malignant lymphomas has shown success in clinical trials, its full potential for the treatment of hematologic malignancies has yet to be realized. To expand the clinical potential of a promising human-mouse chimeric antihuman B-cell MoAb (chCLL-1) constructed using the variable domains cloned from the murine Lym-2 (muLym-2) hybridoma, fusion proteins containing granulocyte-macrophage colony-stimulating factor (GM-CSF) (chCLL-1/GM-CSF) or interleukin (IL)-2 (chCLL-1/IL-2) were generated and evaluated for in vitro cytotoxicity and in vivo tumor targeting. The glutamine synthetase gene amplification system was employed for high level expression of the recombinant fusion proteins. Antigenic specificity was confirmed by a competition radioimmunoassay against ARH-77 human myeloma cells. The activity of chCLL-1/GM-CSF was established by a colony formation assay, and the bioactivity of chCLL-1/IL-2 was confirmed by supporting the growth of an IL-2-dependent T-cell line. Antibody-dependent cellular cytotoxicity against ARH-77 target cells demonstrated that both fusion proteins mediate enhanced tumor cell lysis by human mononuclear cells. Finally, biodistribution and imaging studies in nude mice bearing ARH-77 xenografts indicated that the fusion proteins specifically target the tumors. These in vitro and in vivo data suggest that chCLL-1/GM-CSF and chCLL-1/IL-2 have potential as immunotherapeutic reagents for the treatment of B-cell malignancies.
WITH THE EXCEPTION of a chimeric anti-CD20 monoclonal antibody (MoAb), which has produced tumor regressions in patients with relapsed B-cell non-Hodgkin's lymphoma (NHL),1 unconjugated MoAbs have demonstrated limited therapeutic responses.2 Radioimmunotherapy, on the other hand, has shown considerable promise in clinical studies, particularly in the treatment of B-cell NHL.3 The efficacy of radioimmunotherapy is restricted, however, either by dose-limiting thrombocytopenia or more severely by the presence of bone marrow disease. In these settings, effective therapy with unconjugated MoAbs would be desirable for the induction of tumor remission. For this purpose, the combination of MoAbs and biologic response modifiers has been investigated as a means of increasing tumor lysis. Cytokines including interleukin-2 (IL-2) and granulocyte-macrophage colony-stimulating factor (GM-CSF) have been shown to enhance both in vitro cytotoxicity mediated by MoAbs against tumor targets and in vivo killing of tumor xenografts in animal model systems.4-9 Because of the toxicity of systemically administered cytokines, however, methods are needed to target these biologically potent immunologic mediators to the tumor site. One approach, gene transfer, has demonstrated that tumor cells engineered to secrete cytokines stimulate antitumor immunity and rejection in animal models,10-17 illustrating the importance of localizing cytokines to tumors. However, at the present time, this approach is impractical in the clinical setting. An alternative method is the use of antibody-cytokine fusion proteins to direct such immunologically active molecules to tumor sites.18-20 In this way high local concentrations of cytokines within tumors can be achieved and systemic toxicity is minimized or avoided.
In this report, we describe the development of such molecules for the treatment of hematologic malignancies. Lym-2 is a murine IgG1 MoAb directed against a human major histocompatability complex (MHC) class II variant that is strongly reactive with a high percentage of human B-cell NHL, chronic lymphocytic leukemia, and multiple myeloma cell lines and biopsy specimens.21 Lym-2 has recently been shown to have a direct inhibitory effect on human lymphoma cell lines in vitro and to improve the survival of human lymphoma-bearing severe combined immunodeficiency (SCID) mice by the induction of apoptosis (Funakoshi et al, manuscript in preparation). In antibody-dependent cellular cytotoxicity (ADCC) assays, however, murine Lym-2 mediates low tumor lysis with human mononuclear effector cells. A human-mouse chimeric derivative designated chCLL-1 has therefore been constructed to increase its effector functions. To further enhance the immunotherapeutic potential of this chimeric antibody for the treatment of B-cell malignancies, antibody fusion proteins containing human GM-CSF and IL-2 have been generated. In this study, we describe the effector functions mediated by these recombinant molecules and demonstrate their tumor targeting abilities in a nude mouse xenograft model.
Reagents
Antibodies and Cell Lines
Construction of Expression Vectors The expression vectors were constructed using standard techniques. The expression vector for chCLL-1, 12/chCLL-1/HL, was used as the parent vector. This plasmid contains the cDNA sequences for the human-mouse chimeric CLL-1 heavy and light chains, each under the control of the cytomegalovirus (CMV) major immediate early promoter, and the cDNA sequence for glutamine synthetase, under the control of the SV40 early promoter. Two oligonucleotide primers, 5'- GGTAAAGCGGCCGCAGGAGGTGGTAGCGCACCCGCCCGCTCGCCCAGC - 3' and 5' - TCAATGCGGCCGCTCACTCCTGGACTGGCTCCCAGCA - 3', were used to amplify by polymerase chain reaction (PCR) the human GM-CSF cDNA from the pcD-hGM/Eo-CSF plasmid template. To amplify the human IL-2 cDNA from the pBC12/HIV/IL-2 plasmid template, two primers, 5' - GGTAAAGCGGCCGCAGGAGGTGGTAGCGCACCTACTTCAAGTTCTACA - 3' and 5' - TCATGCGGCCGCTCAAGTTAGTGTTGAGATGATGCT - 3', were used. The PCR fragments were each inserted into the Not I site of 12/chCLL-1/HL, resulting in the expression vectors 12/chCLL-1/HL/GM-CSF and 12/chCLL-1/HL/IL-2, encoding the chimeric light chain and a fusion protein consisting of the chimeric CLL-1 heavy chain with human GM-CSF or human IL-2 at its C-terminus.Expression and Purification of Fusion Proteins The fusion proteins were expressed from NS0 murine myeloma cells according to the protocol of the manufacturer (Celltech Biologics). Briefly, linearized plasmids were electroporated into NS0 cells, which were plated in nonselective Hybridoma-SFM medium. Selective glutamine-free medium was added 24 hours later. When transfectants appeared approximately 3 weeks later, supernatants were tested for the presence of chimeric fusion protein by indirect enzyme-linked immunosorbent assay (ELISA). The highest-producing clones were identified by 24-hour rate of production assays. To maximize the yield of chCLL-1/GM-CSF, amplification of vector copy number was achieved by expanding the clone and incubating the cells in increasing concentrations of methionine sulfoximine, a specific inhibitor of glutamine synthetase. Three to 4 weeks later, viable clones were again assayed for rate of chimeric fusion protein production. After subcloning by limiting dilution, the highest-producing clones were expanded, incubated in 10 L bioreactors, and chCLL-1/GM-CSF and chCLL-1/IL-2 were purified stepwise from cell culture medium by protein A affinity chromatography and ion-exchange chromatography, as described previously.24 The purity of each fusion protein was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a reducing gel according to the method of Laemmli27 and by high performance liquid chromatography (HPLC). The samples were filtered through a 0.22 µm Nalgene disposable filter unit before injection. The fusion proteins were analyzed with a Beckman HPLC Gold System (Beckman Instruments, Fullerton, CA) equipped with two 110B solvent pumps, a 210A valve injector, a 166 programmable UV detector, and a 406 analog interface module. Size exclusion chromatography was performed on a G4000SW column (TosoHaas; Montgomeryville, PA) with 0.1 mol/L PBS, pH 7.2 as the solvent system, eluting at a flow rate of 1 mL/min. The UV absorbance of the HPLC eluate was detected at 280 nm.Immunoassays ELISA. Chimeric fusion protein-containing supernatants were initially identified by indirect ELISA using murine Lym-2 antiidiotype 7E2 MoAb, as described previously.24 For production rate assays, 106 cells were plated in 1 mL of selective medium and allowed to incubate for 24 hours. ELISA was then performed as before. Supernatants were serially diluted and applied to wells of microtiter plates coated with goat antihuman IgG (H+L) (CalTag, South San Francisco, CA). Dilutions of a control chimeric antibody were used to generate a standard curve using 4-parameter fit by an automated ELISA reader (Bio-Tek Instruments, Inc, Winooski, VT), from which concentrations of unknowns were estimated. Rates of production expressed as µg/mL/106 cells/24 hours were compared to identify the highest producing clones.Determination of Avidity To determine the avidity constants of chCLL-1/GM-CSF and chCLL-1/IL-2, a fixed cell radioimmunoassay was performed using the method of Frankel and Gerhard.29 Each experimental variable was run in duplicate. ARH-77 myeloma cell suspensions containing 106 cells/mL were incubated with 10 to 110 ng of 125I-labeled chCLL-1/GM-CSF or chCLL-1/IL-2 in 200 µL PBS for 1 hour at room temperature with constant mixing. The cells were then washed three times with PBS containing 1% bovine serum albumin to remove unbound antibody and counted in a gamma counter. The amount of fusion protein bound was then determined by the remaining cell-bound radioactivity (cpm) in each tube and the specific activity (cpm/ng) of the radiolabeled fusion protein. Scatchard plot analysis was used to obtain the slope. The equilibrium or avidity constant Ka was calculated by the equation K = -(slope/n), where n is the valence of the antibody (2 for IgG).
Isolation of Bone Marrow Cells Bone marrow samples were obtained in preservative-free heparin from normal donors after receiving their informed consent (with the approval of UCLA Institutional Review Board). Cells were diluted with an equal volume of PBS containing 0.6% ACD-A (anticoagulant citrate dextrose solution, Formula A; Baxter-Fenwal Corp, Deerfield, IL) and mononuclear cells (MNC) were isolated by gradient centrifugation on Ficoll-Paque (Pharmacia LKB; Uppsala, Sweden) followed by two washes with PBS/ACD-A. CD34+ cells were purified from MNC using a CD34+ Progenitor Cell Isolation Kit (Miltenyi Biotec; Auburn, CA) without modification of the manufacturer's instructions.Colony Assays Bone marrow MNC (7.5 × 104 cells/well) or CD34+ cells (1 × 104 cells/well) were plated in triplicate in 24-well plates in semisolid medium containing 0.3% bacto agar in Iscove's Modified Dulbecco's Medium, 20% fetal bovine serum (Atlanta Biological, Norcross, GA), 50 µg/mL gentamicin, 0.4 mmol/L L-glutamine. Colony assays were supplemented with either hu-GM-CSF (generously provided by Amgen; Thousand Oaks, CA), chCLL-1/GM-CSF, or chCLL-1. Cultures were maintained humidified at 37°C in 5% CO2. Colonies containing more than 30 cells were enumerated after 14 to 16 days in culture.IL-2 Bioassay Biologic activity of chCLL-1/IL-2 was determined by a standard IL-2-dependent T-cell proliferation assay.30 Carrier-free recombinant IL-2 obtained from Hoffmann La Roche, Inc (Nutley, NJ) was used as a standard. Roche IL-2 stock (7.8 mg/mL, specific activity 12 × 106 IU/mg) was diluted to yield a stock solution containing 2 × 106 IU/mL. Growth of the IL-2-dependent murine T-cell line, CTLL-2, was used to determine the amount of IL-2 bioactivity in a sample. Briefly, serially diluted samples and standard were incubated with 2 × 104 CTLL-2 cells in triplicate for 20 hours at 37°C in 96-well flat bottom microtiter plates. The cells were then pulsed with 0.5 µCi of 3H-thymidine for 6 hours, and the samples were harvested and counted.
Cytotoxicity Assays ADCC was performed using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega, Madison, WI), which is a colorimetric assay that quantitatively measures lactate dehydrogenase release.31 Effector cells were peripheral blood MNC or neutrophilic polymorphonuclear leukocytes (PMN). MNC were isolated from healthy human donors by Ficoll-Paque gradient centrifugation, and PMN were purified by centrifugation through a discontinuous percoll gradient (70% and 62%) followed by hypotonic lysis to remove residual erythrocytes as described previously.32 ARH-77 myeloma cells were used as target cells. ARH-77 cells were suspended in Hybridoma-SFM medium supplemented with 2% fetal bovine serum and plated in 96-well V-bottom microtiter plates at 2 × 104 cells/well. Antibody or fusion protein preparations (chCLL-1/GM-CSF, chCLL-1/IL-2, chCLL-1, muLym-2, or chTNT-1 as an isotype-matched irrelevant control) were added in triplicate to individual wells at 1 µg/mL, and effector cells were added at various effector:target cell ratios (12.5:1 to 50:1). The plates were incubated for 4 hours at 37°C, after which the supernatants were harvested, lactate dehydrogenase release was determined, and % specific lysis was calculated according to the protocol of the manufacturer. Data are reported as mean ± standard deviation (SD). Differences between groups were analyzed by unpaired Student's t-test.Pharmacokinetic and Biodistribution Studies Six-week-old Balb/C mice were used to determine the pharmacokinetic clearance of chCLL-1, chCLL-1/GM-CSF and chCLL-1/IL-2. Groups of mice (n = 5) were administered intraperitoneal (IP) injections of 125I-labeled fusion proteins (30 to 40 µCi/mouse). The whole body activity at injection and at selected times thereafter was measured with a CRC-7 microdosimeter (Capintec, Inc, Pittsburgh, PA). The data were analyzed and half-lives were determined using the RSTRIP pharmacokinetic program (MicroMath, Inc, Salt Lake City, UT). To determine the tissue biodistribution of chCLL-1/GM-CSF and chCLL-1/IL-2, 6-week-old female athymic nude mice were irradiated with 400 rads from a cesium source, 3 days after which they were injected with a 0.2 mL inoculum containing 4 × 107 ARH-77 cells and 4 × 106 human fetal lung fibroblast feeder cells subcutaneously (SC) in the left thigh. The tumors were grown for 3 weeks until they reached approximately 1 cm in diameter. Within each group (n = 5), individual mice were injected intravenously (IV) with a 0.1 mL inoculum containing 100 µCi/10 µg of 125I-labeled fusion protein. Animals were killed by sodium pentobarbital overdose at 72 hours postinjection, and various organs, blood, and tumors were removed and weighed. The radioactivity in the samples was then measured in a gamma counter. For each mouse, data were expressed as percent injected dose/gram (% ID/g) and tumor:organ ratio (cpm per gram tumor/cpm per gram organ). From these data, the mean and SD were calculated for each group.
Imaging Studies ARH-77 human myeloma tumors were grown in the left thighs of athymic nude mice as described above. When the tumors had reached approximately 1 cm in diameter, the mice were injected IV with a 0.1 mL inoculum containing 100 µCi/10 µg of 131I-labeled chCLL-1, chCLL-1/GM-CSF, or chCLL-1/IL-2. At 1, 3, and 5 days postinjection, the mice were anesthetized with a SC injection of 0.8 mg sodium pentobarbital. The immobilized mice were then imaged in a prone position with a Spectrum 91 camera equipped with a pinhole collimator (Raytheon Medical Systems, Melrose Park, IL) set to record 5,000 to 10,000 counts using the Nuclear MAX Plus image analysis software package (MEDX Inc, Wood Dale, IL).
Construction, Expression, and Purification of chCLL-1/GM-CSF and chCLL-1/IL-2 A Not I site was previously appended immediately downstream of the terminal codon of the human 1 sequence by PCR. A PCR fragment containing either the human GM-CSF cDNA or the human IL-2 cDNA preceded by a seven amino acid linker peptide was then inserted into the Not I site, producing CLL-1 VH/human 1/human GM-CSF or CLL-1 VH/human 1/human IL-2 fusion genes (Fig 1). This resulted in the expression vectors 12/chCLL-1/HL/GM-CSF and 12/chCLL-1/HL/IL-2, encoding the chimeric light chain and a fusion protein consisting of the chimeric CLL-1 heavy chain with human GM-CSF or human IL-2 at its C-terminus. The fusion proteins were expressed from NS0 murine myeloma cells using the glutamine synthetase gene amplification system (Celltech Biologics). After subjection to vector amplification, the highest chCLL-1/GM-CSF-producing subclone secreted approximately 26 µg/mL/106 cells/24 hours in static culture. The highest chCLL-1/IL-2-producing subclone expressed approximately 16 µg/mL/106 cells/24 hours. Upon scale-up, greater than 100 µg/mL of chCLL-1/GM-CSF were obtained after purification. When the chCLL-1/IL-2-producing cell line was grown in a 10-L bioreactor, approximately 70 µg/mL of fusion protein were obtained. Both chimeric antibody fusion proteins were properly assembled as demonstrated by reducing SDS-PAGE; two well-defined bands were resolved for chCLL-1/GM-CSF at approximately 25 and 66 kD and for chCLL-1/IL-2 at approximately 25 and 65 kD, corresponding to the molecular weights of the immunoglobulin light chain and heavy chain plus cytokine (Fig 2). Both fusion proteins appeared as a single peak by HPLC analysis (data not shown).
Immunobiochemical Analysis The immunoreactivity of purified chCLL-1/GM-CSF and chCLL-1/IL-2 with the target antigen of muLym-2 was assessed by determining the binding to antigen-bearing ARH-77 myeloma cells. In a radioimmunoassay, increasing concentrations of chCLL-1/GM-CSF, chCLL-1/IL-2, muLym-2, or an irrelevant MoAb (chLym-1) were evaluated for their ability to inhibit the binding of 125I-labeled muLym-2 to ARH-77 cells (Fig 3). Because it binds to a nonoverlapping epitope, chLym-1 was unable to compete with 125I-labeled muLym-2, but chCLL-1/GM-CSF and chCLL-1/IL-2 inhibited 125I-labeled muLym-2 binding to ARH-77 cells. These studies confirm that chCLL-1/GM-CSF and chCLL-1/IL-2 maintain the immunoreactivity of muLym-2.Colony-Forming Activity of chCLL-1/GM-CSF Biologic activity of the GM-CSF moiety was determined by colony assays using both bone marrow MNC and CD34+ cells. As indicated in Fig 4, chCLL-1/GM-CSF compares favorably with recombinant human GM-CSF in its ability to stimulate colony formation from the MNC fraction of normal bone marrow. In addition, the fusion protein is capable of inducing the formation of colonies from isolated CD34+ progenitor cells (data not shown). No colonies formed in the presence of chCLL-1.IL-2 Bioactivity of chCLL-1/IL-2 Biologic activity of the IL-2 moiety was determined by assaying the ability of chCLL-1/IL-2 to support IL-2-dependent T-cell proliferation. A bioassay with the IL-2-dependent CTLL-2 line was performed in which chCLL-1/IL-2 was assayed along with chCLL-1 and the IL-2 standard (Fig 5). On a molar basis, chCLL-1/IL-2 had approximately 50% of the activity required to produce 50% maximum proliferation of the IL-2-dependent cell line compared with the recombinant IL-2 standard. This corresponds to a specific activity of approximately 8 × 105 IU/mg of fusion protein. At higher concentrations (eg, >1 nmol/L), maximum proliferation was achieved as evidenced by the plateau of the incorporation of 3H-thymidine into DNA. As expected, chCLL-1 had no activity.Cytotoxicity Studies chCLL-1/GM-CSF, chCLL-1/IL-2, chCLL-1, and muLym2 were evaluated for their ability to mediate ADCC by colorimetric lactate dehydrogenase release assays against ARH-77 myeloma target cells. At a concentration of 1 µg/mL, chCLL-1 mediated 65% cytotoxicity, while muLym-2 mediated only 10% specific lysis of tumor cells by human MNC at an effector:target cell ratio of 50:1 (Fig 6A). At the same effector:target cell ratio, both fusion proteins mediated approximately 100% specific lysis of target cells (Fig 6B and C). Similar enhancement of specific lysis mediated by both fusion proteins over chCLL-1 and by chCLL-1 over muLym-2 can be seen at lower effector:target cell ratios. The isotype-matched irrelevant control (chTNT-1) mediated <5% specific lysis at all effector:target cell ratios (data not shown). Neither the fusion proteins nor antibodies mediated specific lysis of target cells by human PMN at an effector:target cell ratio of 50:1 (<5%, data not shown).In Vivo Pharmacokinetic and Tumor Targeting Studies Whole body clearance studies were performed to establish differences in pharmacokinetics among chCLL-1/GM-CSF, chCLL-1/IL-2, and chCLL-1. Mice were injected with 125I-labeled fusion proteins or chimeric antibody, and the whole body activity at injection and selected times thereafter was measured with a microdosimeter. chCLL-1/IL-2 cleared rapidly with a whole body half-life of 11 hours (Fig 7). chCLL-1/GM-CSF had a half-life of approximately 30 hours, while chCLL-1 cleared slowly, with a half-life of 100 hours.
In this study, recombinant fusion proteins containing the chimeric MoAb CLL-1 and human GM-CSF or IL-2 have been generated, which retain both tumor targeting and cytokine functions. The GS gene amplification system was used for high level expression of the fusion proteins from myeloma cells so that large-scale production can yield sufficient products to enable clinical studies to be undertaken. With this expression system, gram quantities of the fusion proteins can be produced in batch cultures. Biochemical analysis demonstrates the presence of two GM-CSF or IL-2 molecules per chimeric antibody molecule (Fig 2). GM-CSF or IL-2 is located at the C-terminus of the heavy chain following a short linker peptide to facilitate proper folding of the cytokine. The immunoreactivity of the fusion proteins was retained, as evidenced by competition with 125I-labeled muLym-2 for binding to antigen-bearing ARH-77 myeloma cells (Fig 3). Moreover, the binding affinity of the fusion proteins was unaffected by the presence of the cytokine molecules. In addition, the biological activity of the cytokines within the fusion proteins was confirmed by appropriate assays; chCLL-1/GM-CSF possesses colony-forming activity (Fig 4), while chCLL-1/IL-2 is able to support the proliferation of an IL-2-dependent T-cell line (Fig 5).
Submitted December 16, 1996;
accepted January 31, 1997.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hearly marked ``advertisment'' in accordance with 18 U.S.C. section 1734 solely to indicate this fact.
The authors wish to thank Barbara H. Biela, Jahangir Sharifi, and Myra M. Mizokami for assistance with the animal studies.
1.
Maloney DG,
Liles TM,
Czerwinski DK,
Waldichuk C,
Rosenberg J,
Grillo-Lopez A,
Levy R:
Phase I clinical trial using escalating single-dose infusion of chimeric anti-CD20 monoclonal antibody (IDEC-C2B8) in patients with recurrent B-cell lymphoma.
Blood
84:2457,
1994 2. Dillman RO: Antibodies as cytotoxic therapy. J Clin Oncol 12:1497, 1994[Abstract]
3.
Wilder RB,
DeNardo GL,
DeNardo SJ:
Radioimmunotherapy: Recent results and future directions.
J Clin Oncol
14:1383,
1996 4. Bianchi AC, Heslop HE, Veys P, Macey M, Holland M, Prentice HG, Brenner MK: Enhancement of monoclonal antibody dependent cell mediated cytotoxicity by IL2 and GM-CSF. Br J Haematol 73:468, 1989[Medline] [Order article via Infotrieve]
5.
Vuist WMJ,
Buitenen Fv,
de Rie MA,
Hekman A,
Rümke P,
Melief CJM:
Potentiation by interleukin 2 of Burkitt's lymphoma therapy with anti-pan B (anti-CD19) monoclonal antibodies in a mouse xenotransplantation model.
Cancer Res
49:3783,
1989
6.
Gill I,
Agah R,
Hu E,
Mazumder A:
Synergistic antitumor effects of interleukin 2 and the monoclonal Lym-1 against human Burkitt lymphoma cells in vitro and in vivo.
Cancer Res
49:5377,
1989
7.
Biddle WC,
Pancook J,
Goldrosen M,
Han T,
Foon KA,
Vaickus L:
Antibody-dependent, cell-mediated cytotoxicity by an anti-class II murine monoclonal antibody: Effects of recombinant interleukin 2 on human effector cell lysis of human B-cell tumors.
Cancer Res
50:2991,
1990
8.
Hooijberg E,
Sein JJ,
van den Berk PCM,
Hart AAM,
van der Valk MA,
Kast WM,
Melief CJM,
Hekman A:
Eradication of large human B cell tumors in nude mice with unconjugated CD20 monoclonal antibodies and interleukin 2.
Cancer Res
55:2627,
1995
9.
Ottonello L,
Morone P,
Dapino P,
Dallegri F:
Monoclonal Lym-1 antibody-dependent lysis of B-lymphoblastoid tumor targets by human complement and cytokine-exposed mononuclear and neutrophilic polymorphonuclear leukocytes.
Blood
87:5171,
1996 10. Fearon ER, Pardoll DM, Itaya T, Golumbek P, Levitsky HI, Simons JW, Karasuyama H, Vogelstein B, Frost P: Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60:397, 1990[Medline] [Order article via Infotrieve]
11.
Tsai S-CJ,
Gansbacher B,
Tait L,
Miller FR,
Heppner GH:
Induction of antitumor immunity by interleukin-2 gene-transduced mouse mammary tumor cells versus transduced mammary stromal fibroblasts.
J Natl Cancer Inst
85:546,
1993
12.
Porgador A,
Tzehoval E,
Vadai E,
Feldman M,
Eisenbach L:
Immunotherapy via gene therapy: Comparison of the effects of tumor cells transduced with the interleukin-2, interleukin-6, or interferon-
13.
Cignetti A,
Guarini A,
Carbone A,
Forni M,
Cronin K,
Forni G,
Gansbacher B,
Foa R:
Transduction of the IL2 gene into human acute leukemia cells: Induction of tumor rejection without modifying cell proliferation and IL2 receptor expression.
J Natl Cancer Inst
86:785,
1994 14. Visseren MJW, Koot M, van der Voort EIH, Gravestein LA, Schoenmakers HJ, Kast WM, Zijlstra M, Melief CJM: Production of interleukin-2 by EL4 tumor cells induces natural killer cell- and T-cell-mediated immunity. J Immunother 15:119, 1994 15. Katsanis E, Orchard PJ, Bausero MA, Gorden KB, McIvor RS, Blazar BR: Interleukin-2 gene transfer into murine neuroblastoma decreases tumorigenicity and enhances systemic immunity causing regression of preestablished retroperitoneal tumors. J Immunother 15:81, 1994
16.
Allione A,
Consalvo M,
Nanni P,
Lollini PL,
Cavallo F,
Giovarelli M,
Forni M,
Gulino A,
Colombo MP,
Dellabona P,
Hock H,
Blankenstein T,
Rosenthal FM,
Gansbacher B,
Bosco MC,
Musso T,
Gusella L,
Forni G:
Immunizing and curative potential of replicating and nonreplicating murine mammary adenocarcinoma cells engineered with interleukin (IL)-2, IL-4, IL-7, IL-10, tumor necrosis factor 17. Gunji Y, Tagawa M, Matsubara H, Takenaga K, Shimada H, Kondo F, Suzuki T, Nakajima K, Aoki T, Asano T, Ochiai T, Isono K, Kageyama H, Nakamura Y, Sakiyama S: Murine colon carcinoma cells engineered to produce human interleukin-2 induce tumor-specific anti-tumor response. Int J Cancer 66:135, 1996[Medline] [Order article via Infotrieve]
18.
Gillies SD,
Reilly EB,
Lo K-M,
Reisfeld RA:
Antibody-targeted interleukin 2 stimulates T-cell killing of autologous tumor cells.
Proc Natl Acad Sci USA
89:1428,
1992 19. Fell HP, Gayle MA, Grosmaire L, Ledbetter JA: Genetic construction and characterization of a fusion protein consisting of a chimeric F(ab') with specificity for carcinomas and human IL-2. J Immunol 146:2446, 1991[Abstract]
20.
Sabzevari H,
Gillies SD,
Mueller BM,
Pancook JD,
Reisfeld RA:
A recombinant antibody-interleukin 2 fusion protein suppresses growth of hepatic human neuroblastoma metastases in severe combined immunodeficiency mice.
Proc Natl Acad Sci USA
91:9626,
1994
21.
Epstein AL,
Marder RJ,
Winter JN,
Stathopoulos E,
Chen F-M,
Parker JW,
Taylor CR:
Two new monoclonal antibodies, Lym-1 and Lym-2, reactive with human B-lymphocytes and derived tumors, with immunodiagnostic and immunotherapeutic potential.
Cancer Res
47:830,
1987
22.
Lee F,
Yokota T,
Otsuka T,
Gemmell L,
Larson N,
Luh J,
Arai K,
Rennick D:
Isolation of cDNA for a human granulocyte-macrophage colony-stimulating factor by functional expression in mammalian cells.
Proc Natl Acad Sci USA
82:4360,
1985 23. Cullen BR: Trans-activation of human immunodeficiency virus occurs via a bimodal mechanism. Cell 46:973, 1986[Medline] [Order article via Infotrieve] 24. Hu P, Glasky MS, Yun A, Alauddin MM, Hornick JL, Khawli LA, Epstein AL: A human-mouse chimeric Lym-1 monoclonal antibody with specificity for human lymphomas expressed in a baculovirus system. Hum Antibodies Hybridomas 6:57, 1995[Medline] [Order article via Infotrieve]
25.
Epstein AL,
Chen F-M,
Taylor CR:
A novel method for the detection of necrotic lesions in human cancers.
Cancer Res
48:5842,
1988
26.
Burk KH,
Drewinko B,
Trujillo JM,
Ahearn MJ:
Establishment of a human plasma cell line in vitro.
Cancer Res
38:2508,
1978 27. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680, 1970[Medline] [Order article via Infotrieve] 28. Epstein AL, Marder RJ, Winter JN, Fox RI: Two new monoclonal antibodies (LN-1, LN-2) reactive in B5 formalin-fixed, paraffin-embedded tissues with follicular center and mantle zone human B lymphocytes and derived tumors. J Immunol 133:1028, 1984[Abstract] 29. Frankel ME, Gerhard W: The rapid determination of binding constants for antiviral antibodies by a radioimmunoassay: An analysis of the interaction between hybridoma proteins and influenza virus. Mol Immunol 16:101, 1979[Medline] [Order article via Infotrieve] 30. Anderson PM, Rogosheske JR, Ramsay NKC, Weisdorf DJ: Biological activity of recombinant interleukin-2 in intravenous admixtures containing antibiotic, morphine sulfate, or total parenteral nutrient solution. Am J Hosp Pharm 49:608, 1992[Abstract] 31. Korzeniewski C, Callewaert DM: An enzyme-release assay for natural cytotoxicity. J Immunol Methods 64:313, 1983[Medline] [Order article via Infotrieve]
32.
Elsässer D,
Valerius T,
Repp R,
Weiner GJ,
Deo Y,
Kalden JR,
van de Winkel JGJ,
Stevenson GT,
Glennie MJ,
Gramatzki M:
HLA class II as potential target antigen on malignant B cells for therapy with bispecific antibodies in combination with granulocyte colony-stimulating factor.
Blood
87:3803,
1996
33.
Steplewski Z,
Sun LK,
Shearman CW,
Ghrayeb J,
Daddona P,
Koprowski H:
Biological activity of human-mouse IgG1, IgG2, IgG3, and IgG4 chimeric monoclonal antibodies with antitumor specificity.
Proc Natl Acad Sci USA
85:4852,
1988 34. Naramura M, Gillies SD, Mendelsohn J, Reisfeld RA, Mueller BM: Mechanisms of cellular cytotoxicity mediated by a recombinant antibody-IL2 fusion protein against human melanoma cells. Immunol Lett 39:91, 1994
35.
Hu P,
Hornick JL,
Glasky MS,
Yun A,
Milkie MN,
Khawli LA,
Anderson PM,
Epstein AL:
A chimeric Lym-1/interleukin 2 fusion protein for increasing tumor vascular permeability and enhancing antibody uptake.
Cancer Res
56:4998,
1996 36. Ragnhammar P, Frödin J-E, Trotta PP, Mellstedt H: Cytotoxicity of white blood cells activated by granulocyte-colony-stimulating factor, granulocyte/macrophage-colony-stimulating factor and macrophage-colony-stimulating factor against tumor cells in the presence of various monoclonal antibodies. Cancer Immunol Immunother 39:254, 1994[Medline] [Order article via Infotrieve] |