Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Blood, 1 December 2005, Vol. 106, No. 12, pp. 3985-3987.
Prepublished online as a Blood First Edition Paper on August 9, 2005; DOI 10.1182/blood-2005-04-1550.


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-04-1550v1
106/12/3985    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Priwitzerova, M.
Right arrow Articles by Ponka, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Priwitzerova, M.
Right arrow Articles by Ponka, P.
Related Collections
Right arrow Red Cells
Right arrow Gene Expression
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

RED CELLS
Brief report

Functional consequences of the human DMT1 (SLC11A2) mutation on protein expression and iron uptake

Monika Priwitzerova, Guangjun Nie, Alex D. Sheftel, Dagmar Pospisilova, Vladimir Divoky, and Prem Ponka

From the Departments of Biology, Pediatrics and Hemato-oncology, Faculty of Medicine Palacky University, Olomouc, Czech Republic; and Lady Davis Institute for Medical Research, Jewish General Hospital, Montreal, QC, Canada.


    Abstract
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
We have previously described a case of severe hypochromic microcytic anemia caused by a homozygous mutation in the divalent metal transporter 1 (DMT1 1285G > C). This mutation encodes for an amino acid substitution (E399D) and causes preferential skipping of exon 12 during processing of the DMT1 mRNA. To examine the functional consequences of this mutation, full-length DMT1 transcript with the patient's point mutation or a DMT1 transcript with exon 12 deleted was expressed in Chinese hamster ovary (CHO) cells. Our results demonstrate that the E399D substitution has no effect on protein expression and function. In contrast, deletion of exon 12 led to a decreased expression of the protein and disruption of its subcellular localization and iron uptake activity. We hypothesize that the residual protein in hematopoietic cells represents the functional E399D DMT1 variant, but because of its quantitative reduction, the iron uptake activity of DMT1 in the patient's erythroid cells is severely suppressed.


    Introduction
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Divalent metal transporter 1 (DMT1) protein (also called Nramp2, DCT1, and SLC11A2) plays a crucial role in intestinal iron (Fe2+) absorbtion1,2 and iron transport across the membrane of acidified endosomes.3 DMT1 is an integral membrane protein composed of 12 predicted transmembrane domains (TM) and containing 2 putative glycosylation sites in an extracytoplasmic loop, membrane targeting motifs, and a consensus transport motif.4,5 Recently, Touret et al6 demonstrated that the G185R DMT1 mutant protein found in microcytic anemia (mk) mice7 and the Belgrade (b) rats8 is abnormally processed, less stable, and displays decreased transport activity. We previously reported a Czech female with severe hypochromic microcytic anemia and iron overload caused by a homozygous mutation in the DMT1 gene (1285G > C) that changes Glu 399 to Asp (E399D).9,10 This single nucleotide substitution also causes preferential skipping of exon 12 during mRNA processing. As a consequence, there are 2 different DMT1 transcripts present in the patient's cells: a full-length transcript containing the point mutation and that missing exon 12; the later version comprising 90% of the total DMT1 mRNA. This shorter transcript is in low levels present also in normal control erythroid cells, but it was not detected in duodenum of control subjects.10 Here, we show that DMT1 protein levels in the patient's peripheral blood cells and in her burst-forming unit erythroid (BFU-E) colonies are markedly decreased. Additionally, we investigate the functional consequences of the patient's mutation by expressing different versions of DMT1 in cultured cells and thereby show that both the expression and function of DMT1 protein are disturbed by this mutation.


    Study design
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
Processing of peripheral blood cells

Blood samples of the patient, her heterozygous parents, and healthy donors were obtained with informed consent. The ethics committee of the Palacky University Hospital approved the study. Peripheral blood was collected in heparinized tubes and processed for in vitro colony-forming assay9 and for Western blot analyses. Red blood cells were removed by treatment with NH4Cl. After 2 washes with phosphate-buffered saline (PBS), the protein extracts were prepared by resuspending the cells in 200 µL TNE buffer11 (100 mM NaCl; 10 mM Tris [tris(hydroxymethyl)aminomethane]-Cl, pH 7.0; 10 mM EDTA [ethylenediaminetetraacetic acid]) containing a cocktail of protease inhibitors (Sigma, Oakville, Canada) followed by centrifugation at 13 800g for 10 minutes. Protein concentration was determined by Bradford assay.

Cell culture and transfection

Chinese hamster ovary LR73 (CHO LR73) cells and the Caco-2 cells were grown as described.6,12 The human DMT1 cDNA (non-IRE isoform, generous gift from Dr J. T. Prchal, Baylor College of Medicine, Houston, TX) was tagged by C-terminal HA epitope and inserted into the expression plasmid pcDNA3.1(-) (Invitrogen, Burlington, Canada). Site-directed mutagenesis was performed using the QuikChange and ExSite kits (Stratagene, La Jolla, CA) and allele-specific oligonucleotides: 5'GGCCAGTTTGTCATGGACGGATTCCTGAACCTA3', 5'TAGGTTCAGGAATCCGTCCATGACAAACTGGCC3' to create E399D DMT1; 5'CCCTTTGTAGATGTCCACAGCCAGTGT3',5'GGATTCCTGAACCTAAAGTGGTCACGC'3 to create DEL DMT1. Transfections of CHO cells with WT DMT1, E399D DMT1, DEL DMT1, and empty vectors were performed using lipofectamine reagent (Invitrogen). Clones of stable transfectants were selected as previously described.13

Immunoblot analysis

Total cell lysates from CHO-transfected cells were prepared as described for peripheral blood cells (see "Processing of peripheral blood cells"). Crude membrane fractions were isolated as previously described.11 Protein lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%) and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA). Immunoblots were incubated with primary antibodies: goat anti-Nramp2 antibody (N-20, Santa Cruz Biotechnology, Santa Cruz, CA) or mouse anti-HA antibody (F-7; Santa Cruz Biotechnology). The immune complexes were visualized using Super Signal West Dura Chemiluminescent Substrate (Pierce, Rockford, IL).

Immunofluorescence

Harvested BFU-Es were cytospun, and CHO-transfected cells were seeded in 60-mm plates containing coverslips. The cells were fixed and permeabilized using ice-cold methanol-acetone (1:1) solution. The protein expression was analyzed using goat anti-Nramp2 (N-20) or mouse anti-HA (F-7) antibody. For the subcellular localization experiments, these primary antibodies were used: rabbit anti-early endosomal antigen 1 antibody (EEA1; Alexis, Montreal, Canada) and rabbit anti-calnexin antibody (Stressgen, Victoria, Canada). The slides were analyzed by immunofluorescence or confocal microscopy.

59Fe uptake by CHO cells

The reduction of 59Fe(III) to 59Fe(II) was accomplished by addition of 56FeSO4 (10-fold excess) to 59FeCl3 in 0.1 M HCl. Thirty-six hours after transfection cells were washed twice with PBS prewarmed to 37°C and incubated in 2 mL of prewarmed incubation buffer (25 mM Tris, 25 mM 4-morpholineethanesulfonic acid [MES], 140 mM NaCl, 5.4 mM KCl, 5 mM glucose, 1.8 mM CaCl2, pH 6.0) containing 10 µM 59Fe(II) and 0.44 mM sodium ascorbate at 37°C for 5, 20, and 60 minutes. The 59Fe uptake was terminated by 3 washes with ice-cold PBS. Cells were detached and membrane-associated 59Fe was removed using 30 minutes' incubation (4°C) in 2 mL PBS containing 1 mg/mL pronase plus 5 mM EDTA.14 After 2 additional washes with PBS, the 59Fe radioactivities were measured in a gamma counter (Packard Cobra II auto-gamma; Perkin-Elmer, Wellesley, MA).


    Results and discussion
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 
The effect of the DMT1 1285G > C mutation on the level of protein expression was initially studied in peripheral blood cells. Immunoblotting with an anti-Nramp2 antibody revealed a 64-kDa protein band (Figure 1A), which corresponded to a band seen in the protein extract of Caco-2 cells. The level of DMT1 expression in the patient's cells was clearly decreased compared to her heterozygous parents. Subsequent immunofluorescence analysis on cytospun BFU-Es revealed decreased abundance of DMT1 on the surface of the patient's erythroblasts compared to normal control BFU-E-derived erythroblasts (Figure 2A). These findings suggest that the mechanism of the patient's hypochromic microcytic anemia involves quantitative DMT1 protein reduction.

To evaluate the consequences of the patient's mutation on the functional properties of the DMT1 protein, CHO cells were transiently transfected with HA-tagged expression constructs encoding WT DMT1, E399D DMT1, or DEL DMT1. Western blotting with mouse anti-HA antibody revealed 2 bands in CHO cells expressing WT or E399D DMT1 (Figure 1B), representing the mature complex-glycosylated form (90 to 100 kDa) and the core-glycosylated form (66 kDa) of DMT1 as it has previously been shown for HA-tagged mouse Nramp2.13 In CHO cells expressing the DEL DMT1, only the core-glycosylated form of the protein was detectable (Figure 1B). The absence of complex glycosylation of this protein product is not unexpected since deletion of exon 12 removes TM domain 8; the 2 putative glycosylation sites in DMT1 are present in an extracytoplasmic loop between TM7 and TM8.4 To assess the possibility that the mutation can interfere with the membrane targeting of the protein, crude membrane extracts from CHO-transfected cells were prepared. Subsequent immunoblot analysis revealed the same 2 DMT1 species as detected in total cell lysates (Figure 1C). These results demonstrate that the E399D substitution has no effect on protein expression, its glycosylation, or membrane targeting. A very weak band of core-glycosylated protein also was present in the membrane extract from CHO cells transfected with DEL DMT1. This could either indicate that a small fraction of the protein is targeted to the membrane, or it may represent a fraction of the immature protein present in the endoplasmic reticulum (ER).15 The cellular distribution of the proteins revealed the same pattern of DMT1 staining for WT and E399D DMT1 transfectants (Figure 2Bi-iv), suggesting that the E399D amino acid substitution has no effect on the protein cellular targeting. On the other hand, only a faint signal was observed in CHO cells transfected with DEL DMT1 (Figure 2Bv-vi). These expression patterns were not unique to CHO cells, as the same results were obtained using H1299 cells expressing WT, E399D, and DEL DMT1 (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1.. Expression of DMT1 and iron uptake study. (A) Western blot analysis of peripheral blood cell lysates (90 µg) and Caco-2 cells lysate (30 µg) with primary goat anti-Nramp2 antibody (1/1000, 16 hours, 4°C) and peroxidase-conjugated secondary antibody (Pierce; 1/1000, 90 minutes, room temperature). The 64-kDa band represents the DMT1 protein; lane 1, Caco-2; lane 2, patient's father; lane 3, patient's mother; lane 4, patient. (B-C) Western blot analysis of total cell lysates (30 µg) and crude membrane extracts (50 µg) from CHO cells expressing the empty vector (CHO), WT, E399D, and DEL forms of HA-tagged DMT1 with mouse anti-HA antibody (1/1000, 1 hour, room temperature) and peroxidase-conjugated secondary antibody (1/1000, 90 minutes, room temperature). Mature complex-glycosylated DMT1 form (90 to 100 kDa; {triangleright}) and the core-glycosylated form of DMT1 (66 kDa; {blacktriangleleft}) are indicated. Equal loading of proteins was assessed by probing with an antibody against {beta}-actin or {alpha}-tubulin (1/1000, 1 hour, room temperature). Representative immunoblots of 3 separate experiments are illustrated. (D) Iron transport activities of WT, E399D, and DEL DMT1 incubated in pH 6.0 incubation buffer with 59Fe(II)-ascorbate (10 µM 59Fe). Iron uptake is expressed as intracellular 59Fe (cpm per 106 cells). "CHO empty" represents iron uptake by cells transfected with empty vector. Data shown are the means ± SD of duplicate determinations from a typical experiment that was performed 3 times.

 



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2.. Immunofluorescence analysis of DMT1 in BFU-E-derived erythroblasts and transfected CHO cells. (A) Day 14 healthy control and the patient's BFU-Es were harvested, cytospun, and stained using goat anti-Nramp2 antibody (1/50, 3 hours, room temperature) and fluorescein isothiocyanate (FITC)-conjugated secondary antibody (Molecular Probes, Eugene, OR; 1/1000, 90 minutes, room temperature). (B) Immunostaining of WT (i-ii), E399D (iii-iv) and DEL (v-vi) DMT1 in transiently transfected CHO cells with mouse anti-HA antibody (1/200, 1 hour, room temperature) and FITC-conjugated secondary antibody (1/1000, 1 hour, room temperature). (C) Subcellular localization of E399D DMT1 in early endosomes (i-iii) and DEL DMT1 in the endoplasmic reticulum (iv-vi) in stably transfected CHO cells. Cells immunostained with mouse anti-HA antibody and with FITC-conjugated secondary antibody were subsequently stained either with anti-EEA1 antibody (1/200, 1.5 hours, room temperature) or anti-calnexin antibody (1/200, 1.5 hours, room temperature) followed by incubation with red-fluorescent-conjugated secondary antibody (Alexa Fluor 594, Molecular Probes; 1/1000, 1.5 hours, room temperature). In panels A and C the cells were visualized on an Olympus BX 50 fluorescence microscope (Olympus, Hamburg, Germany) using a 100 x/1.3 numeric aperture (NA) oil immersion objective. Digital images were acquired with an Olympus DP 50 camera driven by the software Viewfinder Lite version 1.0.135 (Pixera, Los Gatos, CA). Original magnifications, x 1000. In panel B the cells were examined on a Zeiss Pascal 5 confocal microscope (Carl Zeiss, Jena, Germany) using a 40 x/0.75 NA objective (i, iii, v) and a 63 x/1.4 NA oil immersion objective (ii, iv, vi). The Zeiss LSM Browser version 3.2.0 115 was used for handling pictures. Images were cropped, assembled, and labeled using Adobe Photoshop software (Adobe Systems, San Jose, CA).

 
To evaluate the iron uptake properties of the E399D and DEL DMT1 proteins, CHO transfectants were exposed to 59Fe(II) and the internalized radioactivity evaluated. The capacity of WT DMT1 and E399D DMT1 to transport iron was comparable (Figure 1D). In contrast, DEL DMT1-transfected CHO cells exhibited no increase in iron uptake, suggesting that deletion of exon 12 abolishes the iron transport function of DMT1.

The absence of the complex-glycosylated form of DEL DMT1 together with the immunofluorescence analysis and the iron uptake experiments in the transiently transfected cells suggested that the cellular trafficking of DEL DMT1 could be erroneous. To determine the subcellular protein localization and to overcome the DEL DMT1 borderline level of expression, stable transfectants expressing WT, E399D, and DEL DMT1 were selected and subjected to immunofluorescence analyses. The observed punctate intracellular staining for WT (not shown) and E399D DMT1 is consistent with the localization of these proteins in early endosomes, which was confirmed using an antibody against EEA1 (Figure 2Ci-iii). In contrast, the DEL DMT1 subcellular localization exhibited overlapping pattern with calnexin, an ER marker (Figure 2Civ-vi). These data show that disrupted complex glycosylation of DEL DMT1 results in retention of the immature form of this protein in the ER. The observed quantitative DMT1 protein reduction in the patient's bone marrow erythroblasts9 and in the patient's BFU-Es indicates that the stability of DEL DMT1 protein might be reduced. As only 10% of the total DMT1 transcript in the patient's erythroid cells encodes for a fully functional E399D protein, it is likely that the erythroid iron use is severely suppressed. The definite cause of the patient's concomitant liver iron overload remains elusive. Our group has previously shown that the total mRNA level of DMT1 in the patient's duodenum are probably not affected and that DMT1 protein expression might even be increased.10 However, it is difficult to make definitive conclusions as both intra-individual and inter-individual differences in the level of DMT1 expression in the duodenum, reflecting the body iron stores and recent iron content in the diet, may exist. Nevertheless, we believe that the liver hemosiderosis evolved as a result of the alteration of a few processes, including activation of heme absorption9 and increased activity of the basolateral iron transport.10


    Footnotes
 
Submitted April 15, 2005; accepted July 31, 2005.

Prepublished online as Blood First Edition Paper, August 9, 2005; DOI 10.1182/blood-2005-04-1550.

Supported by the Canadian Institutes for Health Research (M.P., G.N., A.D.S., and P.P.) and by the Czech Republic Ministry of Health grant NR/7799-3 and Ministry of Education grant MSM 6198959205 (M.P., D.P., and V.D.).

M.P. conducted and designed the experiments and wrote the report; G.N. initiated and designed a part of the experiments; A.D.S. helped with confocal microscopy and the iron uptake study and contributed to the editing of the report; D.P. was responsible for the treatment of the patient and collection of the samples and contributed to the editing of the report; V.D. conceived the study, contributed to ideas in this report, and contributed to the writing of the report; P.P. conceived and designed the study and contributed to the writing of the report.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Prem Ponka, Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 Cote Ste-Catherine Rd, Montreal, H3T 1E2, Quebec, Canada; e-mail: prem.ponka{at}mcgill.ca.


    References
 Top
 Abstract
 Introduction
 Study design
 Results and discussion
 References
 

  1. Gunshin H, Mackenzie B, Berger UV, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997;388: 482-487.[CrossRef][Medline] [Order article via Infotrieve]

  2. Canonne-Hergaux F, Gruenheid S, Ponka P, Gros P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood. 1999;93: 4406-4417.[Abstract/Free Full Text]

  3. Canonne-Hergaux F, Zhang AS, Ponka P, Gros P. Characterization of the iron transporter DMT1 (NRMAP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood. 2001;8: 3823-3830.

  4. Lee P, Gelbart T, West C, Halloran C, Beutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis. 1998;24: 199-215.[CrossRef][Medline] [Order article via Infotrieve]

  5. Picard V, Govoni G, Jabado N, Gros P. Nramp 2 (DCT1/DMT1) expressed at the plasma membrane transports iron and other divalent cations into a calcein-accessible cytoplasmic pool. J Biol Chem. 2000;275: 35738-35745.[Abstract/Free Full Text]

  6. Touret N, Martin-Orozco N, Paroutis P, et al. Molecular and cellular mechanisms underlying iron transport deficiency in microcytic anemia. Blood. 2004;104: 1526-1533.[Abstract/Free Full Text]

  7. Fleming MD, Trenor CC 3rd, Su MA, et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet. 1997;16: 383-386.[CrossRef][Medline] [Order article via Infotrieve]

  8. Fleming MD, Romano MA, Su MA, Garrick LM, Garrick MD, Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci U S A. 1998;95: 1148-1153.[Abstract/Free Full Text]

  9. Priwitzerova M, Pospisilova D, Prchal JT, et al. Severe hypochromic microcytic anemia caused by a congenital defect of the iron transport pathway in erythroid cells. Blood. 2004;103: 3991-3992.[Free Full Text]

  10. Mims MP, Guan Y, Pospisilova D, et al. Identification of a human mutation of DMT1 in a patient with microcytic anemia and iron overload. Blood. 2005;105: 1337-1342.[Abstract/Free Full Text]

  11. Lam-Yuk-Tseung S, Govoni G, Forbes J, Gros P. Iron transport by Nramp2/DMT1: pH regulation of transport by 2 histidines in transmembrane domain 6. Blood. 2003;101: 3699-3707.[Abstract/Free Full Text]

  12. Elisma F, Jumarie C. Evidence for cadmium uptake through Nramp2: metal speciation studies with Caco-2 cells. Biochem Biophys Res Commun. 2001;285: 662-668.[CrossRef][Medline] [Order article via Infotrieve]

  13. Touret N, Furuya W, Forbes J, Gros P, Grinstein S. Dynamic traffic through the recycling compartment couples the metal transporter Nramp2 (DMT1) with the transferrin receptor. J Biol Chem. 2003;278: 25548-25557.[Abstract/Free Full Text]

  14. Graham RM, Morgan EH, Beker E. Ferric citrate uptake by cultured rat hepatocytes is inhibited in the presence of transferrin. Eur J Biochem. 1998;264: 272-274.

  15. Tabushi M, Tanaka N, Nishida-Kitayama J, et al. Alternative splicing regulates the subcelluar localization of divalent metal transporter 1 isoforms. Mol Biol Cell. 2002;13: 4371-4387.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
N. C. Andrews
Forging a field: the golden age of iron biology
Blood, July 15, 2008; 112(2): 219 - 230.
[Full Text] [PDF]


Home page
Exp PhysiolHome page
S. H. Jung, L. R. DeRuisseau, A. N. Kavazis, and K. C. DeRuisseau
Plantaris muscle of aged rats demonstrates iron accumulation and altered expression of iron regulation proteins
Exp Physiol, March 1, 2008; 93(3): 407 - 414.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
C. D. Klaassen and H. Lu
Xenobiotic Transporters: Ascribing Function from Gene Knockout and Mutation Studies
Toxicol. Sci., February 1, 2008; 101(2): 186 - 196.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
K. Thompson, R. M. Molina, J. D. Brain, and M. Wessling-Resnick
Belgrade Rats Display Liver Iron Loading
J. Nutr., December 1, 2006; 136(12): 3010 - 3014.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Lam-Yuk-Tseung, V. Picard, and P. Gros
Identification of a Tyrosine-based Motif (YGSI) in the Amino Terminus of Nramp1 (Slc11a1) That Is Important for Lysosomal Targeting
J. Biol. Chem., October 20, 2006; 281(42): 31677 - 31688.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Pospisilova, M. P. Mims, E. Nemeth, T. Ganz, and J. T. Prchal
DMT1 mutation: response of anemia to darbepoetin administration and implications for iron homeostasis.
Blood, July 1, 2006; 108(1): 404 - 405.
[Full Text] [PDF]


Home page
BloodHome page
C. Beaumont, J. Delaunay, G. Hetet, B. Grandchamp, M. de Montalembert, and G. Tchernia
Two new human DMT1 gene mutations in a patient with microcytic anemia, low ferritinemia, and liver iron overload
Blood, May 15, 2006; 107(10): 4168 - 4170.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-04-1550v1
106/12/3985    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Priwitzerova, M.
Right arrow Articles by Ponka, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Priwitzerova, M.
Right arrow Articles by Ponka, P.
Related Collections
Right arrow Red Cells
Right arrow Gene Expression
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2005 by American Society of Hematology         Online ISSN: 1528-0020